Labshake search
Citations for Roche :
2551 - 2600 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... for real-time quantitative PCR (RT-qPCR) in a LightCycler®480 System (Roche). The following primers were used for determination of intracellular ZIKV genomes (fwd 5’ agatcccggctgaaacactg 3’ ...
-
bioRxiv - Cell Biology 2024Quote: ... The protein pellets were suspended in in cOmplete Protease Inhibitor Cocktail (Roche) containing radio-immunoprecipitation assay (RIPA ...
-
bioRxiv - Cell Biology 2024Quote: Cell proliferation was measured using WST-1 (water-soluble tetrazolium) assay (Roche, Cat # 501003295) according to standard manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... and quantitative PCR (KAPA Biosystems). Barcoded libraries were then pooled and sequenced on the HiSeq2000 (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... Sample cDNA and library quality controls were performed using the Agilent 4200 TapeStation instrument and quantified by qPCR (Kapa Biosystems/Roche). Libraries were sequenced on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... sEVs lysis was performed with cOmplete™ Lysis-M buffer (Roche Diagnostics GmbH, Mannheim, Germany), 10 µg of sEVs separated by SDS-PAGE gels were transferred to polyvinylidene difluoride membrane (PVDF ...
-
bioRxiv - Cell Biology 2024Quote: ... Libraries were constructed using the KAPA mRNA HyperPrep Kit (KAPA Biosystems). Library quality and concentration were checked using the D5000 Screen Tape (Agilent Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... Sample cDNA and library quality controls were performed using the Agilent 4200 TapeStation instrument and quantified by qPCR (Kapa Biosystems/Roche). Libraries were sequenced on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... 20 µg/mL DNase I (Roche, #10104159001), 20 µg/mL RNase A (QIAGEN ...
-
bioRxiv - Cell Biology 2024Quote: ... and laminin (Roche, 11243217001) at approximately 1–2 ×106 cells/cm2 ...
-
bioRxiv - Cell Biology 2024Quote: ... with the LightCycler96 software (Roche). Gapdh was used as a housekeeping gene ...
-
bioRxiv - Cell Biology 2024Quote: ... Gene expression levels were quantified by Reverse Transcription quantitative polymerase chain reaction (RT–qPCR) using the LightCycler 480 Real-Time PCR System (Roche, Basel, Switzerland). Cycling parameters were set at (i ...
-
bioRxiv - Cell Biology 2024Quote: ... The second digestion step with collagenase/ dispase (Roche) is performed again first for 30 min at 4°C and then for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: RNA extraction from cultured cells has been performed using the High Pure RNA Isolation Kit (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... MycTrap beads were pre-incubated with yeast tRNA (Roche, Switzerland) to block non-specific RNA binding in 0.15M KCl Wash Buffer supplemented with 0.5mM DTT and 40U/ml RiboLock RNase inhibitor (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... 100μg/ml RNase A (10109169001 - Roche) in PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... and 0.5 mg/mL DNase I (Roche, Cat # 11284932001). The reaction was halted by adding 1 μL of 0.5M EDTA (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were labeled for translation by anti-HA antibodies (12CA5, Roche) and with JF646 HaloTag ligand for mRNAs.
-
bioRxiv - Cell Biology 2024Quote: ... cell nuclei were counterstained using 40,60-diamidino-2-phenylindol (DAPI, Roche, Mannheim, Germany). Labeled cells were washed three times with TBS before being covered with Fluoromount mounting medium (Southern Biotech ...
-
bioRxiv - Cell Biology 2024Quote: ... GFP was blocked with anti-GFP antibody (Roche) and ubiquitin was blocked with anti-ubiquitin was detected using an anti-GFP antibody (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... and ubiquitin was blocked with anti-ubiquitin was detected using an anti-GFP antibody (Roche) and ubiquitin was detected using an anti-ubiquitin antibody (Santa Cruz) ...
-
bioRxiv - Cell Biology 2024Quote: ... After washes, the cells were stained with the DNA stain DAPI (4, 6 diamidino-2-phenylindole dihydrochloride) (Roche, #1023627001) and mounded with Prolong gold anti-fade mound media (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were washed with 1X PBS and were resuspended in 1 mL of 1X Triton Lysis Buffer (50mM Tris pH 7.5, 150mM NaCl, 0.5% Triton and cOmplete, EDTA-free Protease Inhibitor Cocktail (Roche)) ...
-
bioRxiv - Cell Biology 2024Quote: ... Blood glucose was quantified using an ACCU-CKEK glucometer (Roche, Germany) following tail vein-puncture of whole blood sampling ...
-
bioRxiv - Cancer Biology 2024Quote: ... 0.01% Triton™ (Roche; Basel, Switzerland) in PBS ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was isolated from cell lines using TriPure (Roche) and reverse transcribed (RT ...
-
bioRxiv - Cancer Biology 2024Quote: ... The beads were magnetically separated as above and pooled eluate added to PCR strip tubes containing 2X KAPA HiFi HotStart ReadyMix (Roche, Cat# 07958935001) and 2 mM each of P5 (AATGATACGGCGACCACCGAGATCTACA*C ...
-
bioRxiv - Cancer Biology 2024Quote: ... and DNase I (0.1 mg/ml, Roche, 11284932001) in RPMI for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time qPCR was performed using KAPA SYBR FAST mix (Kapa Biosystems, #KK4660) with a StepOne real-time PCR instrument (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2024Quote: Lenti-vectors were prepared in 293T cells using X-tremeGene HP DNA transfection reagent (Roche), with psPAX2 and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: KPC-4662 tumors from sedentary and exercised mice were harvested and immediately digested in HBSS with DNase I (100 µg/mL; Roche, 04716728001) and collagenase type II (10mg/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... and treated with RNase-free DNase (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Immunoblots were performed using α-GFP (Roche) or α-HA antibodies (Roche).
-
bioRxiv - Cancer Biology 2024Quote: ... Cell pellets were resuspended in 1x PLB (10x PLB: 1 M KCl, 50 mM MgCl2, 100 mM HEPES-NaOH pH 7.5, 5% NP-40, Roche protease and phosphatase inhibitors (1 tab each per 10 mL) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell pellets were resuspended in 1x PLB (10x PLB: 1 M KCl, 50 mM MgCl2, 100 mM HEPES-NaOH pH 7.5, 5% NP-40, Roche protease and phosphatase inhibitors (1 tab each per 10 mL) ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-p53 (#05278775001, Roche), anti-MDM2 (#113-0230 ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were incubated overnight at −80 °C in mitochondrial homogenization buffer (250mM sucrose, 1mM EDTA, 10mM Tris (pH 7.4) supplemented with protease (cCompleteTM, EDTA-free Protease Inhibitor Cocktail, Roche, 05056489001) and phosphatase (PhosSTOPTM ...
-
bioRxiv - Neuroscience 2024Quote: ... and phosphatase (PhosSTOPTM, Roche, 04906837001) inhibitors ...
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with protease (cCompleteTM, EDTA-free Protease Inhibitor Cocktail, Roche, 05056489001) and phosphatase (PhosSTOPTM ...
-
bioRxiv - Neuroscience 2024Quote: ... and phosphatase (PhosSTOPTM, Roche, 04906837001) inhibitors ...
-
bioRxiv - Neuroscience 2024Quote: ... Larvae were incubated overnight at 4°C in horseradish peroxidase-coupled anti-FITC antiserum (11426346910, Roche) diluted 1:500 in blocking solution ...
-
bioRxiv - Neuroscience 2024Quote: ... and incubated overnight at 4°C in horseradish peroxidase-coupled anti-DIG antiserum (11207733910, Roche) diluted 1:500 in blocking solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... or Light Cycler 96 system (Roche, Basel, Switzerland; Exp. 2). The species-specific primer-probe set for each target region of Ayu was shown in Table 1 (see Result) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Proteins were detected with anti-HA antibody (Roche, Cat#11867423001).
-
bioRxiv - Neuroscience 2024Quote: ... and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP; 11383221001, Roche) was performed in alkaline phosphatase reaction buffer [100 mM Tris pH 9.5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.1% IGEPAL-CA630) containing protease (cOmplete Mini, Roche) and phosphatase inhibitors (PhosSTOP ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were blocked for 30 min and then incubated in an alkaline phosphatase conjugated anti-DIG antibody (1:600, Roche). Slides were then washed and developed overnight in BCIP/NBT chromogen (Perkin Elmer) ...
-
bioRxiv - Biochemistry 2024Quote: ... DSF was performed in a Light Cycler 480 II (Roche Applied Science, Penzberg, Germany) using a 4 °C/min temperature gradient from 20 °C to 95 °C ...
-
bioRxiv - Biophysics 2024Quote: ... to which DNAse I was added to a final concentration of 20 µg/ml together with an EDTA-free protease inhibitor tablet (Roche Applied Science). Cells were disrupted by 3 cycles of freeze/thaw and the suspension was then homogenized using an ultrasonic processor (QSonica) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1 × phosphatase inhibitor (PhosSTOP, 04906837001, Roche, Basel, Switzerland).