Labshake search
Citations for Roche :
2001 - 2050 of 3852 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... on a 384-well LightCycler 480 Real-Time PCR System (Roche) and threshold cycle (Ct ...
-
bioRxiv - Microbiology 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were clustered on four flow cell lanes ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR was performed using KAPA HiFi HotStart ReadyMix (Roche, Basel, Switzerland) and a MiniAmpPlus thermal cycler (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were clustered on a flowcell ...
-
bioRxiv - Developmental Biology 2023Quote: ... qRT-PCR reactions were run in a LightCycler 480 Instrument (Roche) using a 5 μl reaction mixture of DNA SYBR Green I Master (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA).
-
bioRxiv - Biochemistry 2023Quote: ... These were generated using a PCR DIG Probe Synthesis Kit (Roche) according to the manufacture’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... Quantitative PCR was performed on a 480 Light Cycler thermocycler (Roche) using the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were multiplexed and clustered on one lane of a flowcell ...
-
bioRxiv - Microbiology 2024Quote: ... and purified with the High Pure PCR product purification kit (Roche). Sequencing indexes were added by LGC ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative PCR was carried out in a LightCycler 480 instrument (Roche) with specific primers (Table 2 ...
-
bioRxiv - Microbiology 2023Quote: ... and amplified by PCR with KAPA HiFi HotStart Ready Mix (Roche). PCR conditions consisted of 15 min at 37°C followed by 12 cycles of 98°C for 30 sec ...
-
bioRxiv - Neuroscience 2023Quote: ... The qRT-PCR was done with SYBR Green I Master (Roche) on a LightCycler 480 (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR amplification was conducted using KAPA HiFi HotStart ReadyMix (Roche) and amplicons were analyzed by gel electrophoresis followed by sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... qRT-PCR measurements were carried out on a Lightcycler 480 (Roche) using Lightcycler 480 multiwell plates (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... and performed using the LightCycler 480 Real-Time PCR Instrument (Roche). The amplification protocol was performed as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). Reads were aligned against National Center for Biotechnology Information Build 37 (hg19 ...
-
bioRxiv - Neuroscience 2023Quote: ... libraries are quantified using quantitative PCR (kit purchased from KAPA Biosystems) with probes specific to the ends of the adapters ...
-
bioRxiv - Cell Biology 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were clustered on one flowcell lane ...
-
bioRxiv - Microbiology 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA).
-
bioRxiv - Microbiology 2023Quote: ... PCR was amplified with KAPA HiFi HotStart DNA Polymerase (Roche, Switzerland) using genomic DNA of A ...
-
bioRxiv - Genetics 2024Quote: ... The sequencing library was generated using two Kappa PCR reactions (Roche) with primers detailed in table 4 ...
-
bioRxiv - Developmental Biology 2024Quote: ... template switching reaction and PCR pre-amplification (KAPA HiFi HotStart (Roche), 18 cycles ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Quantitative PCR (qPCR) was performed on a LightCycler 480 System (Roche) using LightCycler 480 SYBR Green I Master Mix reagents (Roche) ...
-
bioRxiv - Neuroscience 2024Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA).
-
bioRxiv - Genetics 2024Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The libraries were multiplexed and clustered onto two flowcells and were loaded onto an Illumina HiSeq 4000 instrument ...
-
bioRxiv - Cell Biology 2024Quote: ... qRT-PCR was performed on a Light Cycler 480 instrument (Roche). Each PCR reaction contained 0.6 µM of the primers specific to the genes of interest ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was purified with High Pure PCR Product Purification Kit (Roche) and analyzed by Digital Droplet PCR (Biorad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... After purification with the High Pure PCR Cleanup Micro Kit (Roche), through T-A ligation ...
-
bioRxiv - Neuroscience 2024Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were multiplexed and clustered onto a flowcell ...
-
bioRxiv - Neuroscience 2024Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were multiplexed and clustered on a flowcell ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA was purified again using High Pure PCR Purification Kit (Roche) per manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: DNA was isolated using High Pure PCR Template Preparation Kit (Roche) per manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were clustered on flowcell lanes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1.50 μl 10x PCR reaction buffer including 15 mM MgCl2 (Roche); 1.50 μl dNTPs mix (250 μM each dNTP) ...
-
bioRxiv - Immunology 2024Quote: ... Libraries were quantitated using real-time PCR (Kapa Biosystems, Wilmington, MA). Libraries were pooled and Single read ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse transcribed using Transcriptor High Fidelity cDNA Synthesis Kit and a specific 3’-UTR DENV-1 primer (Roche Applied Science, Mannheim, Germany), d1a5B 5’-AGAACCTGTTGATTCAACRGC-3’ (62) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The intergenic region for the FANG was amplified using 6P9a5F and GAP3R (S1) primers using the 1U KAPA Taq polymerase (Kapa Biosystems, Boston, MA, USA) in 1X buffer A ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 μL of each primer at 10 μM and 0.5 μL of 1 U/μL Kapa HiFi HotStart DNA polymerase (Kapa Biosystems, Inc, A Roche Company) for a total volume of 25 μL ...
-
bioRxiv - Pathology 2022Quote: ... Analysis and amplification of the product were performed using standard primer and probe concentrations with a commercially available master mix (LC480 ProbesMaster, Roche Applied Sciences, Indianapolis, IN) on a commercially available real-time PCR platform (LightCycler 480 ...
-
bioRxiv - Biophysics 2024Quote: ... to a final molal concentration of 25 ng/μL and amplified using primers specific to each oligonucleotide subpool with KAPA SYBR FAST qPCR (KAPA Biosystems; 1-ng template). A second PCR amplification was performed with KAPA HiFi (KAPA Biosystems ...
-
bioRxiv - Plant Biology 2023Quote: ... and purified based on the manufacturer’s instructions before sample barcoding with xGen Stubby Adapter and Unique Dual Index Primers (IDT) and library preparation using KAPA HyperPrep Kit (Kapa Biosystems-Roche, Wilmington, MA). The library was then sequenced by Illumina MiSeq nano PE150 at the Georgia Genomics and Bioinformatics Core ...
-
bioRxiv - Genomics 2022Quote: ... All Mediator knock-out lines were verified as homozygous for the appropriate T-DNA insertion and transcript levels were quantified by RT-qPCR using a Roche 454 (Roche, Clifton NJ, USA) as described previously (Crawford et al. ...
-
bioRxiv - Immunology 2024Quote: ... Brains were homogenized using a glass Potter and digested for 45 min at room temperature (RT) in Hanks’ balanced salt solution (HBSS) medium with collagenase D (1 mg/ml, Roche Diagnostics cat # 11088882001) and deoxyribonuclease (DNase ...
-
bioRxiv - Pathology 2023Quote: ... The RT-qPCR reactions were performed as recommended by the kit protocol and run on a Roche Light Cycler (Roche, Indianapolis, IN, USA). The limit for cycle of quantification was defined at less than 29 ...
-
bioRxiv - Microbiology 2023Quote: ... 5 µl RNA eluate was used in a RVFV RT-qPCR using the LightCycler one-tube RNA Amplification Kit HybProbe (Roche, Almere, The Netherlands) in combination with a LightCycler 480 real-time PCR system (Roche ...
-
bioRxiv - Plant Biology 2022Quote: ... RT-qPCR reactions were performed using the LightCycler® 480 SYBR Green I Master Mix with a LightCycler 480 instrument (Roche Applied Science, UK) under the following conditions ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reverse transcription (RT) was performed from 2-3 µg of RNA with the Transcriptor First Strand cDNA Synthesis Kit (Roche Life Sciences, Basel, Switzerland) using random hexamer primers ...
-
bioRxiv - Cancer Biology 2024Quote: ... RT-qPCR was performed using the AMPLIQON 2x qPCR Master Mix Green-No ROX using a LightCycler® 96 System (Roche Life Science, Germany) according to the manufacturer’s instructions ...