Labshake search
Citations for Roche :
1951 - 2000 of 3852 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... and purified using a PCR purification kit (Roche, Upper Bavaria, Germany). Linearized plasmids were used as templates for the in vitro transcription reaction using the T7 MegaScript kit ...
-
bioRxiv - Microbiology 2022Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were pooled and sequenced using a 2×150bp Paired End (PE ...
-
bioRxiv - Immunology 2022Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were clustered onto 2 flowcell lanes ...
-
bioRxiv - Microbiology 2022Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). Multiplexed and clustered sequencing libraries were sequenced using Illumina Hiseq 2×150 bp paired-end configuration.
-
bioRxiv - Immunology 2022Quote: ... Germline transcription was analyzed using quantitative PCR with SYBR Green (Roche) and primers for Sμ (ImUF ...
-
bioRxiv - Systems Biology 2022Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were multiplexed and clustered onto 3 flowcell lanes ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... All PCR were performed using KAPA HiFi DNA Polymerase (Roche 0795884600) with primers described in supplementary table 1 ...
-
bioRxiv - Neuroscience 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA).
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative PCR was performed with a Light Cycler 96 instrument (Roche) using KOD SYBR qRT-PCR Mix (TOYOBO) ...
-
bioRxiv - Microbiology 2022Quote: ... with final elution of templates in 40 μL PCR water (Roche) as described previously (Vuillemin et al. ...
-
bioRxiv - Immunology 2022Quote: ... index PCR was performed with Kapa HiFi HotStart Ready Mix (Roche) for 8 cycles with 2.5µL each Nextera Chromium i7 Sample Indices N Set A (PN 3000262 ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR was performed with the KAPA HiFi HotStart ReadyMix (KAPA Biosystems), followed by a purification step with AMPure XP beads (Beckman ...
-
bioRxiv - Microbiology 2024Quote: ... and purified with the High Pure PCR product purification kit (Roche). Sequencing indexes were added by LGC ...
-
bioRxiv - Microbiology 2023Quote: ... and amplified by PCR with KAPA HiFi HotStart Ready Mix (Roche). PCR conditions consisted of 15 min at 37°C followed by 12 cycles of 98°C for 30 sec ...
-
bioRxiv - Microbiology 2024Quote: ... and run on a LightCycler 480 real-time PCR instrument (Roche). The quantified libraries were then multiplexed and the pool of libraries was then prepared for sequencing on the Illumina NovaSeq 6000 sequencing platform using NovaSeq XP v1 reagent kits (Illumina) ...
-
Modular structure of RNA 3’ processing condensates involving the Arabidopsis RNA binding protein FCAbioRxiv - Molecular Biology 2024Quote: ... Quantitative PCR (qPCR) analysis was conducted on a LightCycler480 II (ROCHE), and the qPCR data were normalized to the reference genes UBC and PP2A ...
-
bioRxiv - Molecular Biology 2023Quote: ... amplified and indexed by PCR with KAPA HiFi HotStart ReadyMix (Roche) for sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative PCR was carried out in a LightCycler 480 instrument (Roche) with specific primers (Table 2 ...
-
bioRxiv - Microbiology 2023Quote: ... PCR was amplified with KAPA HiFi HotStart DNA Polymerase (Roche, Switzerland) using genomic DNA of A ...
-
bioRxiv - Neuroscience 2023Quote: ... Real-time PCR was performed on a Real-time system (Roche) using SYBR green supermix (Vazyme) ...
-
bioRxiv - Immunology 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries for bulk and ultra-low samples were multiplexed and clustered onto a flowcell on the Illumina NovaSeq instrument according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... qRT-PCR analyses were performed using the Lightcycler480 system (Roche diagnostics) and SYBR Premix Ex Taq (Takara ...
-
bioRxiv - Immunology 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA).
-
bioRxiv - Genomics 2024Quote: ... and HTO were performed in 1X KAPA HiFi PCR reagent (Roche) with 1 µM of forward primer and 1 µM of reverse primer and thermal protocol as specified below ...
-
bioRxiv - Genomics 2024Quote: ... with SYBR Green 2× PCR Master Mix I (Roche, Cat# 04887352001) and 1 μM of forward and reverse primer respectively ...
-
bioRxiv - Immunology 2024Quote: ... and subsequent PCR with the KAPA HiFi HotStart Ready Mix (Roche) and ISO SMART primer as per the standard protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA).
-
bioRxiv - Bioengineering 2024Quote: ... Indexing PCR was performed using KAPA HiFi HotStart Ready Mix (Roche), 0.067 ng of PCR template and 0.5 μM of indexed primers in the total reaction volume of 25 μL ...
-
bioRxiv - Cancer Biology 2024Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were clustered on a lane of a HiSeq flowcell ...
-
bioRxiv - Microbiology 2023Quote: ... Amplicons were purified using High Pure PCR Product Purification Kit (Roche). Primers are listed in Table S5.
-
bioRxiv - Neuroscience 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were multiplexed and clustered on one lane of a flowcell ...
-
bioRxiv - Microbiology 2023Quote: ... In this PCR the KAPA HiFi HotStart Readymix (KAPA Biosystems, Roche) was used to amplify the samples in triplicates ...
-
bioRxiv - Microbiology 2023Quote: ... In this PCR the KAPA HiFi HotStart Readymix (KAPA Biosystems, Roche) was used to amplify the samples in triplicates ...
-
bioRxiv - Physiology 2022Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA).
-
bioRxiv - Evolutionary Biology 2022Quote: 2 μl 1x proteinase K (recombinant PCR Grade, 25 mg - Roche) dissolved in 2,5 ml TE (10 mg/ml ...
-
bioRxiv - Microbiology 2023Quote: ... in combination with a LightCycler 480 real-time PCR system (Roche) and the RVS forward primers (AAAGGAACAATGGACTCTGGTCA) ...
-
bioRxiv - Neuroscience 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The libraries were then multiplexed and sequenced on an Illumina HiSeq 4000 instrument using a 2×150bp paired-end configuration according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR reactions included KAPA Long Range HotStart DNA Polymerase (KAPA Biosystems) [48] ...
-
bioRxiv - Cell Biology 2023Quote: ... with SYBR Green PCR Master Mix (Cat No. KM4101; KAPA Biosystems) using validated primers specific to each target of each gene.
-
bioRxiv - Bioengineering 2022Quote: Genomic PCR was performed using KAPA HiFi HotStart DNA Polymerase (Roche) with the primers listed in Supplementary Table 1 ...
-
bioRxiv - Microbiology 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were multiplexed and clustered on a flowcell ...
-
bioRxiv - Immunology 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were multiplexed and clustered onto a flowcell ...
-
bioRxiv - Neuroscience 2023Quote: ... The Light Cycler® 480 Real-Time PCR System (Roche, Germany) was used to perform qPCR.
-
bioRxiv - Cancer Biology 2023Quote: ... and the LightCycler® 480 Real-Time PCR (Roche Life Science) system ...
-
bioRxiv - Microbiology 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). DNA libraries were multiplexed and loaded on an Illumina MiSeq instrument according to manufacturer’s instructions (Illumina ...
-
bioRxiv - Genetics 2023Quote: ... and lncRNA AC069262.1 using qRT-PCR LightCycler 480 Instrument II (Roche) using specific primers and iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Genomics 2023Quote: ... and the Kapa HiFi Uracil+ PCR system (cat#: KK2801, Kapa Biosystems) with the following cycling parameters ...
-
bioRxiv - Genomics 2023Quote: ... on a 384-well LightCycler 480 Real-Time PCR System (Roche) and threshold cycle (Ct ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR was performed using KAPA HiFi HotStart ReadyMix (Roche, Basel, Switzerland) and a MiniAmpPlus thermal cycler (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were clustered on a flowcell ...