Labshake search
Citations for Roche :
151 - 200 of 996 citations for Recombinant Human ITGAV & ITGB5 Protein His Avi tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Remaining intracellular biotinylated ligands were assessed by streptavidin-POD (#11089153001, 1:10000, Roche) in Q-PBS ...
-
bioRxiv - Genomics 2019Quote: ... Index tagged samples were amplified (6 cycles of PCR, KAPA HiFi kit, KAPA Biosystems), quantified (Accuclear dsDNA Quantitation Solution ...
-
bioRxiv - Bioengineering 2019Quote: ... Human Fibronectin (Roche). Agar low melting point ...
-
bioRxiv - Neuroscience 2020Quote: Total proteins from mouse cerebella or human cerebellar cortex were obtained by lysis in RIPA buffer containing protease inhibitors (Complete, Roche Diagnostics), followed by sonication and centrifugation using an established protocol in the laboratory31 ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then stimulated with recombinant murine TNF-α (Roche) at 70-80% cell confluency ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Proteinase K (194 μg/ml, recombinant, PCR grade, Roche) for 2 hours at 56 °C to achieve cell lysis and protein digestion ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 1x DNase buffer and 200U recombinant DNase I (Roche) at 37°C for 30 minutes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and DNA libraries were amplified with KAPA 2X Hi-Fi Hotstart Readymix (Roche).
-
bioRxiv - Biophysics 2019Quote: ... the crude extracts mixed with cOmplete His-Tag purification resin (Roche, Basel, Switzerland) were loaded onto a polyprep chromatography column (Bio-Rad ...
-
bioRxiv - Cancer Biology 2021Quote: ... Full length cDNA amplification with Hi-Fi Hotstart Readymix (Roche, cat. no. 07959079001) was completed with a 98°C incubation then 21 cycles of (98°C for 15 sec ...
-
bioRxiv - Genomics 2021Quote: ... The Hi-C library was quantified using a KAPA library quantification kit (Roche), and further PCR amplification was performed using Phusion Hot Start II DNA polymerase (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 µL of the Ni-NTA slurry (Roche cOmplete His-Tag purification resin) was washed with 2x1 mL of wash buffer (WB ...
-
bioRxiv - Genomics 2024Quote: ... The cleared lysate was loaded onto a cOmplete His-tag purification column (Roche) and the His6-Sumo3-Tn5 was eluted with a running buffer containing 300 mM imidazole ...
-
bioRxiv - Molecular Biology 2023Quote: ... After gap repair with Kapa Hi-Fi HotStart Uracil+ DNA Polymerase (KAPA Biosystems) and Taq DNA Ligase (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the supernatant was loaded into cOmplete™ His-Tag Purification Resin (Roche) pre-equilibrated with wash buffer ...
-
bioRxiv - Biophysics 2023Quote: ... the lysate was incubated for 1h with cOmplete His-Tag Purification Resin (Roche) at 4°C ...
-
bioRxiv - Genetics 2023Quote: ... or zebrafish genomic DNA using the Expand Hi-Fidelity PCR System (11732641001, Roche). Exact coordinates are listed in Supplemental Table 3 ...
-
bioRxiv - Biochemistry 2024Quote: ... Supernatants after high-speed centrifugation were loaded onto His-Tag Purific Resin (Roche), washed and eluted with 50 mM Tris.HCl pH 7.5 ...
-
bioRxiv - Microbiology 2020Quote: Biotinylated HIV-1 FISH probes were prepared with the Nick Translation Kit (Roche, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Biotinylated RNAs were transcribed in vitro with Biotin-RNA Labeling Mix (Roche, Indianapolis, IN) and purified with quick spin RNA columns (Roche ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hybridized probes were detected using anti-digoxigenin (DIG) antibodies tagged with alkaline-phosphatase (AP) (Roche) using NBT/BCIP (Roche ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The HA-tagged tdnano construct was stained using a rat α-HA primary antibody (Roche) and an Alexa Fluor 647-conjugated secondary antibody (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Immunology 2020Quote: ... Purified individually tagged libraries were quantified by qPCR using Kapa Lib Quant Kit (Roche Diagnostics). In conjunction with the qPCR Ct values we used a library size of 265 bp to calculate library molarity ...
-
bioRxiv - Microbiology 2020Quote: ... and recombinant interleukin (IL)-2 (20U/ml; Hoffmann-La Roche, Italy). Cells without peptide stimulation and anti-CD3-stimulated (1μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 20 U/ml of recombinant huIL-2 (Roche, 11147528001) and then plated into 12 well plates previously coated for 2 hours RT with 1 μg/ml of huCD28.2 (BioLegend ...
-
bioRxiv - Microbiology 2022Quote: Removal of DNA was conducted with Recombinant DNase I (Roche Diagnostics) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissue was incubated with 100 μL of recombinant Proteinase K (Roche) diluted to ∼2 mg/mL in 1 x tris-EDTA (TE ...
-
bioRxiv - Evolutionary Biology 2022Quote: 2 μl 1x proteinase K (recombinant PCR Grade, 25 mg - Roche) dissolved in 2,5 ml TE (10 mg/ml ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µg of RNA were treated with Recombinant DNase I (Roche) and cDNA was synthesized using Superscript IV reverse transcriptase (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... and 20 µg/ml Recombinant RNase-free DNase I (Roche, #04716728001)) ...
-
bioRxiv - Cell Biology 2021Quote: ... human plasma fibronectin (Roche) was conjugated with Atto-647N using a protein labeling kit (cat # 76508 Sigma-Aldrich) ...
-
bioRxiv - Genomics 2023Quote: ... Human genomic DNA (Roche) was amplified ...
-
bioRxiv - Molecular Biology 2019Quote: ... The supernatant was added to a slurry of cOmplete His-Tag Purification Resin (Roche) and incubated for 1 h at room temperature or 2 h at 4°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was added to a slurry of cOmplete His-Tag Purification Resin (Roche) or Ni Sepharose High Performance (Merck ...
-
bioRxiv - Microbiology 2021Quote: ... Fab was purified from cell culture supernatant by cOmplete His-Tag Purification Resin (Roche).
-
bioRxiv - Genomics 2024Quote: ... the dialyzed sample was loaded again onto a cOmplete His-tag purification column (Roche), and the untagged Tn5 was collected in the flow-through ...
-
bioRxiv - Molecular Biology 2024Quote: ... The cleared lysate was added to cOmplete His-Tag Purification Resin (Merck Millipore/Roche) and incubated at 4°C for 1.5 h ...
-
bioRxiv - Biochemistry 2020Quote: ... Fractionated samples were analyzed by SDS-PAGE and electrophoresis for detection of HA-tagged Nedd4 (Roche anti-HA high affinity,1:2000 dilution ...
-
bioRxiv - Biochemistry 2020Quote: ... transfected with recombinant EMBacY BACs using X-tremeGENE DNA Transfection Reagent (Roche), and incubated for 72 h at 28 °C ...
-
bioRxiv - Systems Biology 2020Quote: ... The tissue was digested with Liberase Blendzyme 3 recombinant collagenase (Roche Diagnostics) according to the manufacturer instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and treated with DNAse I (Dnase I recombinant RNAse-free, Roche Diagnostics). Then cDNA were produced from 5 μL of total RNA using RT Superscript III (RT Superscript III First Strand cDNA Synthesis Kit ...
-
bioRxiv - Cell Biology 2020Quote: ... Genomic DNA was removed by digestion using DNase I Recombinant (Roche, 04716728001) and RiboLock RNase Inhibitor (Thermo Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... Recombinant baculovirus was generated by initial lipofection with Xtreme gene reagent (Roche) of Sf21 insect cells (Invitrogen) ...
-
bioRxiv - Neuroscience 2022Quote: ... and basic fibroblast growth factor (bFGF, 10 ng/ml; recombinant bovine, Roche). The cells were then plated in a 96-well plate in complete neurosphere medium containing DMEM/F-12 EGF and bFGF ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1x DNase buffer (500ul) and 200U recombinant DNase I (20ul, Roche, 04716728001) at 37 C in a shaker set at 100 RPM ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA contamination was removed through treatment with recombinant DNaseI (Roche Diagnostics, #04716728001) for 15 minutes at RT and column purification using Qiagen RNeasy Mini kit (#74106) ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA contaminations were eliminated with DNase I recombinant (#04716728001; Roche Applied Science) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 µg RNA was treated with 10 units recombinant DNase I (Roche) for 1 h at 37 ° C ...
-
bioRxiv - Biophysics 2019Quote: ... (5) motor solution consisting of 2 μM biotinylated KIF1A in motor dilution buffer (1mM ATP [Roche] ...