Labshake search
Citations for Roche :
1801 - 1850 of 8559 citations for 6 Methyl 2 3 4 9 tetrahydro 1H carbazol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 5 µl RNA eluate was used in a RVFV RT-qPCR using the LightCycler one-tube RNA Amplification Kit HybProbe (Roche, Almere, The Netherlands) in combination with a LightCycler 480 real-time PCR system (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... Reverse transcription and real-time qPCR reaction were carried out with KAPA SYBR FAST One-Step qRT-PCR Master Mix Kit (KAPA Biosystems, Wilmington, MA) on LighyCycler 480 system (Roche ...
-
bioRxiv - Physiology 2024Quote: ... Fish were manually chased for three minutes and exposed to air for one minute before being transferred to the respirometry chamber (Roche et al., 2013). ṀO2 was continuously measured for ∼ 15 minutes to estimate MMR ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 mM CaCl2, 5 mM EGTA, 50 mM sucrose, 0.1% Triton X-100, 1/2 tablet of cOmplete inhibitor [Roche], and 2.5 U/mL Benzonase [Novagen]), lysed by sonication ...
-
bioRxiv - Neuroscience 2023Quote: ... 500 mM NaCl, 1 mM MgCl2, 10 mM Imidazole, 0.5% IGEPAL® CA-630, 2 mM β-Mercapto-ethanol supplemented with Roche cOmplete inhibitor cocktail tablets) at a ratio of 15 ml of buffer/g of biomass ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were then cultured with 2 μg/ml of plate-bound anti-CD3 and anti-CD28 monoclonal antibodies (αCD3αCD28 stimulation) (mAbs) (eBioscience) and 25 U/ml of recombinant human interleukin-2 (IL-2; Roche Applied Science) at a concentration of 1.5-2 × 106 cells/ml in RPMI supplemented with 10% heat-inactivated Human Serum (HS ...
-
bioRxiv - Microbiology 2021Quote: ... 2 mM MgCl2; 2 mM EGTA pH 8.0; 0.1% Triton X-100; 0.1 mM PMSF; 1x Roche Complete protease inhibitors cocktail) supplemented with increasing NaCl concentrations (80-600 mM ...
-
bioRxiv - Cancer Biology 2022Quote: NGS libraries were prepared from extracted gDNAs following a 2-step PCR protocol with 2 x KAPA Mastermix (KK2612, KAPA Biosystems). For spleen Tregs and CD4s ...
-
bioRxiv - Cancer Biology 2024Quote: ... The aqueous phase from each MaXtract tube (∼400 µl) was then transferred to 1.5 ml tubes containing 2 µl of 2 µg/µl glycogen (Roche, Cat# 10901393001), 1 ml ethanol was added ...
-
bioRxiv - Physiology 2020Quote: ... Sigma Aldrich) with 3% bovine serum albumin (BSA, 735078, Roche Diagnostics GmbH, Mannheim, Germany), 20 µg/ml gentamicin (G1397 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and measured each at least 3 times (technical replicates) in the LightCycler96 (Roche, Germany). We detected expression using SYBRgreen marker (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Immunology 2022Quote: ... containing 3 mL of RPMI media with 70 μg / mL of Liberase TM (Roche) and 30 μg / mL of Dnase I (Roche) ...
-
bioRxiv - Immunology 2019Quote: Mouse lungs were homogenized in HEPES buffer with Liberase Blendzyme 3 (70ug/ml; Roche) and DNaseI (30ug/ml ...
-
bioRxiv - Biophysics 2020Quote: ... The oocytes were treated with collagenase A (3 mg/ml; Roche (Grenzach-Wyhlen, Germany)) for 105 min in Ca2+-free Barth’s solution containing (in mM ...
-
bioRxiv - Plant Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3’end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell samples were incubated with 300 nM DAPI (Cat# 28718-90-3, Roche) in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was completed with 3% BSA protease free (Roche Ref# 03 117 332 001) for 1 hour at RT ...
-
bioRxiv - Developmental Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). 10 picomols of each probe were used for each slide ...
-
bioRxiv - Immunology 2023Quote: ... minced with razor blade and digested enzymatically with 3 mg/mL collagenase/dispase (Roche) at 37 °C for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Genetics 2023Quote: ... Bound protein/protein complexes were washed 3 times ((1x TBS, 0.5% Nonident P40 (Roche), 1% phosphatase inhibitor cocktail 2 and 3 (Sigma)) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Immunology 2024Quote: ... containing 3 mL of RPMI media with 70 µg / mL of Liberase TM (Roche) and 30 µg / mL of DNase I (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... containing 0.5% BSA and 3 mg/mL DNAse I grade II (Roche, Cat# 104159). Once resuspended ...
-
bioRxiv - Biochemistry 2022Quote: ... The cell pellet collected from 6 L growth was resuspended in 20 mM HEPES (pH 7.8) containing protease inhibitor cocktail (Roche) and DNase I (Sigma) ...
-
bioRxiv - Genomics 2020Quote: ... primers listed in Supplementary Table 6 were used to perform two consecutive PCR reactions with KAPA HiFi polymerase (Roche). Starting from 100 ng of library plasmid ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were plated onto collagen-coated plates and transfected at 60-80% confluency using FuGENE 6 (Roche, Indianapolis, IN) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... and packaging plasmids PEx-QV and pMD-G were co-transfected into HEK 293T cells using Fugene 6 (Roche). After 4 days ...
-
bioRxiv - Neuroscience 2021Quote: ... The library amplification step included 6-7 PCR cycles and was performed using the KAPA Library Amplification kit (Roche). The final Hi-C library was purified using SPRIselect beads and the quality and size of the library (approximately 500 bp ...
-
bioRxiv - Cell Biology 2022Quote: ... The protein lysate was electrophoresed into 6-10% SDS-PAGE gels and transferred to a PVDF membrane (Roche, 03010040001). After blocking with 5% BSA ...
-
bioRxiv - Immunology 2019Quote: ... 4μg of Env DNA containing CMV promoter was combined with 4μg of SG3Δenv backbone and FuGene 6 transfection reagent (Roche Diagnostics) was added as per manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... 400ng of total RNA (RIN >6) was used to generate polyA-selected libraries with Kapa mRNA HyperPrep kits (Roche) with indexed adaptors ...
-
bioRxiv - Microbiology 2023Quote: 10-25ml of bacterial cultures were pelleted and resuspended in extraction buffer (50mM Tris-HCl pH 7.5, 5mM EDTA, and 6% SDS) with protease inhibitor cocktail (Roche; 1mg/ml Aprotinin ...
-
bioRxiv - Systems Biology 2023Quote: Glucose concentrations from the chemostat samples were determined enzymatically with a solution of hexokinase/glucose-6-phosphate dehydrogenase (Roche) in Pipes buffer at pH 7 ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 μg pAcBAC3 plasmid was used to transfect RAW 264.7 cells by mixing the DNA with 6 μg X-tremeGENE HP DNA Transfection Reagent (Roche) according to the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2023Quote: RNA extraction from A549 cells grown in 6-well plates was done using High Pure RNA isolation kit (Roche). Transcriptor First strand kit (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: ... αSMA-tk;RFP mice and C57BL/6 mice received intraperitoneal (i.p.) injections with 12.5 mg/kg of body weight of ganciclovir (GCV, Cymevene®, Roche) every 48h ...
-
bioRxiv - Developmental Biology 2019Quote: ... then incubated overnight at 4°C with anti-DIG antibody (Roche #11093274910) at 1:5000 in block ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 4 μL of 500 ug/ml RNase (Roche, Cat. No 11119915001) was added and incubated for 1 h at 37° C to digest RNA ...
-
bioRxiv - Neuroscience 2021Quote: ... and visualized by staining with 4-nitro blue tetrazolium (NBT, #11383213001, Roche), 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...
-
bioRxiv - Neuroscience 2020Quote: Animals were perfused and post-fixed overnight using 4% paraformaldehyde (HistoFix, Roche). Vibratome sections (100-200 μm ...
-
bioRxiv - Immunology 2021Quote: ... Live/dead cell exclusion was performed with DAPI (4′-phenylindole dihydrochloride; Roche) or LIVE/dead fixable dye (Thermofisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and incubated with 4 μl of DIG-Prime kit (Roche, Mannheim, Germany), overnight at 37°C ...
-
Maize AFP1 confers antifungal activity by inhibiting chitin deacetylases from a broad range of fungibioRxiv - Microbiology 2021Quote: ... overnight at 4 °C in presence of protease inhibitor cocktail (Roche, Switzerland). The beads were washed with buffer W ...
-
bioRxiv - Developmental Biology 2024Quote: ... then incubated overnight at 4°C with anti-DIG antibody (11093274910, Roche) at 1:5000 in blocking buffer ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 5 mM MgCl2) containing 4-nitro blue tetrazolium chloride (NBT, Roche), 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...