Labshake search
Citations for Roche :
101 - 150 of 807 citations for Creatine Kinase M Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... 5% blocking reagent (Roche) containing 2.5 μg ml-1 Cy-3-labelled telomere specific (CCCTAA ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2% blocking reagent (Roche), 20% heat inactivated goat serum and then incubated overnight with anti-DIG antibody (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1% Blocking reagent (Roche) and 10% goat serum ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.5% blocking reagent (Roche). The first probe (0.8μM ...
-
bioRxiv - Physiology 2023Quote: ... 5% blocking reagent (Roche), with 1.0 μg/mL of Cy3-labeled telomere-specific (CCCTAA ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5 % blocking reagent (Roche), 10 mM Tris-HCl (pH 7.2)) ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking reagent (Roche, 11096176001), PBS (Genesee ...
-
bioRxiv - Developmental Biology 2020Quote: ... blocking was in 5% Horse Serum (X?) and 0.5% Western Blocking Reagent (Roche) MABTween solution and anti-DIG-POD was used ...
-
bioRxiv - Zoology 2020Quote: ... buds were incubated 45 mins in a blocking solution (Blocking Reagent (BR) (Roche) at 2% and saponine (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... The semi-intact cells were then incubated at 30 °C with 2mg/ml rat liver cytosol (RLC), 200 μM GTP or GMPPNP (Wako, number SAH3766) and an ATP regeneration system consisting of 4mM creatine phosphate (Roche), 0.02 mg/ml of creatine phosphokinase (Roche) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The slides were incubated in blocking solution (10% sheep serum, 2% blocking reagent (Roche), 0.3% Tween-20 in MAB ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were blocked for 2 hours in blocking solution (1% blocking reagent; (Roche, 11096176001) in malic acid buffer (0.15M maleic acid ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5% blocking reagent (Roche, Germany)] containing 2.5 μg/mlCy-3-labelled telomere-specific (CCCTAA ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... and 3% Blocking Reagent (Roche) to the hybridization mix during overnight blocking and hybridization of the probe ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2% Blocking reagent (Roche, 11096176001), 0.1% Tween 20 ...
-
bioRxiv - Neuroscience 2020Quote: ... using 2 % blocking reagent (Roche), followed by the detection of the Dig-labelled riboprobe with an anti-DIG Fab fragment conjugated with alkaline phosphatase (1:750 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2% blocking reagent (Roche – 1096176001), 20% heat-inactivated goat serum and then incubated overnight with anti-DIG-AP antibody (Roche – 11093274910 ...
-
bioRxiv - Physiology 2022Quote: ... 0.25% Blocking Reagent (Roche 11096176001), and 0.5μg/ml Telomeric PNA-Cy3 probe (Panagene)-were added to each slide ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were washed in PBSTr and incubated overnight at 4 °C MABTr/10% sheep serum (Sigma-Aldrich)/2% Blocking solution (Roche, Switzerland) with anti-Fluorescein-POD Fab fragments serum (1:500 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were incubated overnight at 4°C in 0.1M malic acid/0.1%-TritonX (MABTr)/10% sheep serum (Sigma-Aldrich)/2% Blocking solution (Roche, Switzerland) with anti-DIG-AP Fab fragments serum (1:5000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... embryos were incubated overnight at 4 °C in blocking solution MABTr/10% sheep serum (Sigma-Aldrich)/2% Blocking solution (Roche, Switzerland) with anti-DIG-POD Fab fragments serum (1:500 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5% Blocking reagent (Roche 11096176001) and 10 mM Tris ...
-
bioRxiv - Physiology 2022Quote: ... 1.98% Blocking Reagent (11096176001, Roche), 49.5% formamide ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% blocking reagent (Roche, 11096176001), 1% bovine serum albumin (Sigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5mg/ml blocking reagent (Roche), and 0.5ug/ml biotinylated LNA probe against SATII (based on the sequence ATTCCATTCAGATTCCATTCGATC (Swanson et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... in 2% Blocking Reagent (Roche) and 5% sheep serum (Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 0.5% blocking solution (Roche)] containing 100nM telomeric PNA probe TelC-FITC (F1009 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... 2% blocking reagent (Roche, #11096176001), 10% heat-inactivated sheep serum (Equitech-Bio ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% blocking reagent (Roche #11096176001) in MABT at room temperature for 30 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 0.5% blocking solution (Roche)] containing 100nM telomeric PNA probe TelC-FITC (F1009 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3% Blocking Reagent (Roche) to the hybridization mix during overnight blocking and hybridization of the probe ...
-
bioRxiv - Biophysics 2021Quote: ... Phosphoenolpyruvate (PEP) and pyruvate kinase (PK) were procured from Roche Diagnostics ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 U/mL rabbit pyruvate kinase (Roche Diagnostics, Cat# 10128155001), 8 U/mL lactate dehydrogenase (Sigma-Aldrich)) ...
-
bioRxiv - Biochemistry 2023Quote: ... 8.4 U/mL pyruvate kinase (Roche Diagnostics GmbH, Mannheim, Germany), 0.1 mg/mL BSA and 200 mM NADH ...
-
bioRxiv - Neuroscience 2022Quote: ... After blocking for 1-2h with the 1% blocking reagent (Roche Applied Science, cat# 10057177103), sections were incubated with alkaline phosphatase-conjugated anti-DIG antibody (1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... pH 7.5) and blocked in MABT blocking buffer [MABT containing 1% blocking reagent (Roche #11096176001)] with 10% sheep serum for 2,5 hours at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... pH 7.5) and blocked in MABT blocking buffer [MABT containing 1% blocking reagent (Roche #11096176001)] with 10% sheep serum for 2.5 hours at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were lysed in 8 M urea buffer (8 M urea, 1 M Tris pH 7.4, 5 M NaCl) containing protease and phosphatase inhibitors (Roche) followed by sonication at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were incubated in staining solution (1 M Tris-HCl pH 9.5, 5 M NaCl, 1 M MgCl2, NBT-BCIP, H2O) (Roche) in the dark for 10 min at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: Immunostaining was performed after FISH development by re-blocking planarians in Blocking Solution (5% heat inactivated horse serum, 5% Roche Western Blocking Buffer in TNTx) for 2 hours at room temperature ...
-
bioRxiv - Immunology 2021Quote: Cells were collected in RIPA buffer (0.5 M EDTA, 1 M Tris-Cl pH7.5, 1 M NaCl, 200 mM, Roche protease inhibitor) at 0h ...
-
bioRxiv - Cell Biology 2019Quote: ... 3) 2hr RT incubation in blocking solution (5% Sheep Serum, 1% Roche Blocking Buffer in PBST); 4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Blocking of membranes was carried out in buffer 2 (buffer 1 plus 1% blocking reagent (Roche)) for 30 min ...
-
bioRxiv - Neuroscience 2022Quote: ... Slides were incubated in ISH blocking buffer (10% lamb serum 0.2% Roche blocking reagent in TBS) for 1 hour at room temperature and then incubated overnight at 4°C in HRP-conjugated anti-DIG or anti-FL antibodies (in key resource table) ...
-
bioRxiv - Neuroscience 2022Quote: ... Following 1 hour incubation in blocking buffer (10% lamb serum, 0.2% Roche blocking reagent in TBS), the slides were incubated overnight at 4°C in HRP-conjugated anti-DIG or anti-FL antibodies ...
-
Single-cell analysis of shared signatures and transcriptional diversity during zebrafish developmentbioRxiv - Developmental Biology 2023Quote: ... animals in PBST were rocked in 2% blocking buffer (5 g of blocking reagent, Roche, 11096176001) in 1X maleate buffer (150mM maleic acid ...
-
bioRxiv - Developmental Biology 2023Quote: ... Slides were then washed in 0.2x SSC and MBST before blocking with 2% blocking solution (Roche) for at least 1 hour at room temperature ...
-
bioRxiv - Plant Biology 2024Quote: ... slides were incubated at room temperature for 30 min in a blocking solution (Blocking Reagent Roche), and then with primary Anti-APG8A/ATG8A antibody (ab77003 ...
-
bioRxiv - Cell Biology 2019Quote: ... blocked with blocking reagent (Roche/Merk) and incubated with anti-DIG antibody conjugated with alkaline phosphatase (AP) ...
-
bioRxiv - Cell Biology 2020Quote: ... blocked in 1xWestern Blocking Reagent (Roche) and labeled for IF imaging ...