Labshake search
Citations for Roche :
701 - 750 of 9189 citations for 8 2 5 dimethyl 4 chlorophenylsulfonamido 1 naphthol 3 6 disulfonic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... The qPCR reaction was carried out in 8 μl with a primer concentration of 1 μM and SYBR Green Master mix (Roche) in a Roche LightCycler 480 system ...
-
bioRxiv - Plant Biology 2022Quote: ... then ground in 500 μl freshly prepared lysis buffer (25 mM Tris HCl pH 8, 150 mM NaCl, 1% SDS, 1x cOmplete ULTRA protease inhibitor (Roche), and 1x PhosSTOP (Roche)) ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were incubated with 8-keto-NeuAc derivatives for 24 h and proliferation measured using WST-1 (Roche Applied Science) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... The cell pellets were treated with lysis buffer (50 µg/mL digitonin, 75 mM NaCl, 1 mM NaH2PO4, 8 mM Na2HPO4, 250 mM sucrose, and Roche cOmpleteTM protease inhibitor cocktail ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were disrupted in 1% NP-40 lysis buffer (140 mM NaCl, 10 mM Tris-HCl pH 8, 1% NP-40) supplemented with proteinase inhibitors (Roche). Proteins were separated by electrophoresis (SDS-PAGE) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The final pellet was resuspended in 750 uL nuclear lysis buffer (10 mM EDTA, 1% SDS, 50 mM Tris-HCl at pH 8, 1x cOmplete protease inhibitor cocktails (Roche)) ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were washed with ice-cold PBS and scraped into lysis buffer (1 mM EPPS, 8 M urea, protease (complete mini, EDTA-free) inhibitors (Roche) and PhosSTOP phosphatase inhibitor (Roche)) ...
-
bioRxiv - Plant Biology 2022Quote: ... the supernatant was centrifuged at 20000 g for 30 min at 4°C and the resulting pellet was solubilized with lysis buffer (20 mM Tris–HCl pH 8, 150 mM NaCl, 1% TritonX100, Complete EDTA-free Protease Inhibitor cocktail (Roche), PhosSTOP phosphatase inhibitor cocktail (Roche) ...
-
bioRxiv - Neuroscience 2023Quote: ... Five volumes of 50 mM Tris pH 8 was added and proteins were digested over night with trypsin (1:50) (Roche) at 37°C while shaking at 800 rpm ...
-
bioRxiv - Molecular Biology 2023Quote: ... were lysed by sonication in ∼140 mL lysis buffer (50 mM Tris-HCl pH 8, 250 mM KCl, 1 mM TCEP) supplemented with protease inhibitor cocktail (Roche) and DNase I (5 μg/ml ...
-
bioRxiv - Biochemistry 2023Quote: ... The pellet was resuspended in 30 mL of 40 mM Tris pH 8 supplemented with 1 tablet of EDTA-free protease inhibitor tablet (Roche), and 0.1 mM PMSF ...
-
bioRxiv - Molecular Biology 2023Quote: ... Frozen cell pellets were resuspended in 300 μL of cold hypotonic buffer (10 mM Tris-HCl pH 8, 1.5 mM MgCl2, 1 mM KCl, 10X PhosphoSTOP (Roche, 4906845001), 2X Protease Inhibitor Cocktail (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: ... and twice with TE wash buffer (10 mM Tris-HCl pH 8, 1 mM EDTA, 1x Roche protease inhibitor mixture).
-
bioRxiv - Evolutionary Biology 2024Quote: ... and lysed in 50 μL of lysis buffer (50 mM Tris, pH 8, 150 mM NaCl, 1% Triton-X-100, 1x cOmplete EDTA-free protease inhibitor cocktail [Roche]) at 4 °C for 15 min ...
-
bioRxiv - Developmental Biology 2019Quote: ... probes were synthesized at 37°C for 2-4 hrs in digoxigenin-synthesis reaction mixture with T3 RNA polymerase (Roche). After synthesis ...
-
bioRxiv - Biochemistry 2022Quote: ... were homogenized in 7x w/v homogenization buffer (320 mM sucrose, 4 mM HEPES–NaOH, 2 mM EDTA, and Complete protease inhibitor mix (Roche), pH 7.4 ...
-
bioRxiv - Microbiology 2022Quote: ... The plate was sealed and centrifuged (2 minutes, 180×g, 4°C) before analysis with the LightCycler 480 Instrument II (Roche; Preincubation ...
-
bioRxiv - Molecular Biology 2020Quote: ... fully 2’O-methylated antisense RNA oligonucleotide using an additional amount of 4 μL X-tremeGENE HP DNA transfection reagent (Roche) per 1 μg oligonucleotide ...
-
bioRxiv - Molecular Biology 2020Quote: ... fully 2’O-methylated antisense RNA oligonucleotide in 530 μL medium with 4 μL X-tremeGENE HP DNA transfection reagent (Roche) per 1 μg oligonucleotide ...
-
bioRxiv - Neuroscience 2019Quote: ... The resulting supernatant is the soluble fraction and the insoluble fraction is generated by resuspending the pellet in urea buffer (30 mM Tris, 7 M Urea, 2 M Thiourea, 4% CHAPS, 1X Protease Inhibitor Cocktail (Roche), 0.5 mM PMSF ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.5 % sodium deoxycholate and 1 % Triton X-100 as well as protease inhibitors (10 mg / ml leupeptin, pepstatin A, 4-(2-aminoethyl) benzensulfonyl-fluorid and aprotinin) and phosphatase inhibitors (PhosSTOP−, Roche). Total cell lysates were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was diluted to 2 ng/µL and 4 µL were added to 10 µL 2x FastStart Universal SYBR Green PCR Master (Roche). Each sample was run in triplicate using iTaq Universal SYBR Green Supermix (BioRad ...
-
bioRxiv - Developmental Biology 2024Quote: ... The samples were then blocked in blocking solution (maleic acid buffer containing 2% Boehringher-Mannheim blocking reagent) and incubated overnight at 4°C in blocking solution containing anti digoxigenin antibody (Roche) diluted at 1:2000 ...
-
bioRxiv - Genetics 2023Quote: ... for 30 min at room temperature and incubated for 2 h at room temperature or overnight at 4°C with primary antibodies against GFP (Roche), androgen receptor (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Probes were synthesized at 37°C for 2–4 hrs in digoxigenin-synthesis reaction mixture with T7 RNA polymerase (Roche). After synthesis ...
-
bioRxiv - Cell Biology 2024Quote: ... the cells were pelleted by centrifugation (750 x g, 2 min, RT) and washed in 4 ml vPBS containing EDTA-free protease inhibitor (Roche). The washed cells were again pelleted by centrifugation (750 x g ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were pelleted by centrifugation (750 x g, 2 min, 4 °C) and resuspended in 50 μl vPBS containing EDTA-free protease inhibitor (Roche). The cells were fixed by addition of 0.5 ml ice-cold fixation solution (4% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... 500 μL of whole cell extract (WCE) was incubated overnight at 4°C with 2 μg anti-c-myc antibodies (mouse monoclonal, clone 9E10, Roche) for immunoprecipitation of myc-tagged proteins ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were lysed in Buffer A (2 M NaCl, 20 mM HEPES pH 7.5, 20 mM Imidazole, 5 mM βME, protease inhibitor (Roche)) by sonication ...
-
bioRxiv - Developmental Biology 2022Quote: ... DIG-labelled cDNA probe was incubated at 95 °C for 10 min and immediately placed in the ice for 5 min before adding to the hybridization buffer (5x SSC, 50 % formamide, 0.02 % SDS, 2 % blocking agent (Roche), DEPC-treated water) ...
-
bioRxiv - Neuroscience 2023Quote: ... cells and sections were processed for BrdU immunodetection following the manufacturer’s recommendations (5-Bromo-2′-deoxy- uridine Labelling and Detection Kit I, Roche). The slides were mounted for fluorescent microscopy in ProLong® Diamond Antifade Mountant with DAPI (Life Technologies).
-
Conserved Cis-Acting Range Extender Element Mediates Extreme Long-Range Enhancer Activity in MammalsbioRxiv - Genomics 2024Quote: ... embryos were with PBT (x3, 15mins) and incubated in prehybridization buffer (50% deionized formamide, 5× SSC, pH 4.5, 2% Roche Blocking Reagent ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.1% (v/v) 2-mercaptoethanol and 1× protease inhibitors (Roche; 11836170001). Insoluble material was removed by centrifuging at >12,000 × g for 10 min at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... or with 1:10 Dnase I (stock 2 U/μL, Roche), and micrococcal nuclease (stock 2000 U/μL ...
-
bioRxiv - Immunology 2022Quote: ... 2 ml of DMEM with 0.26 U ml−1 LiberaseTM (Roche) and 0.25 mg ml−1 DNase I (Roche ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 μg ml-1 pepstatin and protease inhibitor cocktail tablets (Roche). The cells were then lysed by sonication and cell debris was removed by centrifugation at 30,000 g for 45 min at 4° C ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 μg ml-1 pepstatin and protease inhibitor cocktail tablets (Roche) and lysed with an EmulsiFlex-C3 homogenizer at pressures above 20,000 psi ...
-
bioRxiv - Molecular Biology 2019Quote: pLKO.1 lentiviral construct along with packaging vector ΔVPR and VSVG plasmids were transfected using Fugene-6 (Roche) or PEI (POLYSCIENCES 23966-2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and glands minced with surgical scissors before enzymatical dissociation for 1.5h in DMEM/F12 (1:1) supplemented with 2 mg mL−1 collagenase (Roche) + Gentamicin (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... each fatty acid was first conjugated to 10% fatty-acid-free BSA (bovine serum albumin fraction V) (#10735086001, Roche) for 1 hour at 50°C in a 50:50 volumetric ratio ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Blocking of membranes was carried out in buffer 2 (buffer 1 plus 1% blocking reagent (Roche)) for 30 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... with 8% PFA in PBS supplemented with phosSTOP (Roche) for 1 hour at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-IL6R (tocilizumab: Roche, Basel, Switzerland; 8 µg/mL), α-gp130 (R&D Systems ...
-
bioRxiv - Cell Biology 2020Quote: ... Sections were blocked for 1 hr at room temperature (RT) in 3% BSA (Roche; 10735086001), 0.05% Tween (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... 3 × 104 HMEC-1 cells were seeded into an E-16 multi-well plate (Roche) in triplicate and incubated for 72 h ...
-
bioRxiv - Microbiology 2019Quote: ... frozen pellets were thawed and resuspended in 1 ml of 3 mg/ml lysozyme (Roche) and 0.4 mg/ml proteinase K (Ambion ...
-
bioRxiv - Biochemistry 2024Quote: ... A ∼3:1 ratio of X-tremeGENE™ 9 DNA Transfection Reagent (Roche, XTG9-RO) was added to the mixture prior to incubation and application on HEK293T cells using standard methods 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... After addition of the extraction solution containing 1% acetic acid and Complete Mini protease inhibitor cocktail (Roche, Basel, Switzerland) in 1:2 w/v proportion ...