Labshake search
Citations for Merck :
1 - 50 of 291 citations for ssc mir 17 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Primers for reverse-transcription PCR (RT-PCR) and quantitative RT-PCR (qRT-PCR) were supplied by Merck with standard desalting at 100 µM in TE buffer ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 1.8 ul of LD forward primer set pools (10 uM per primer, provided by MERCK) using 25 ul of Q5 Hot Start Master Mix (2X ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 1 ul of FR1 forward primer set pools (10 uM per primer, provided by MERCK) using 25 ul of Q5 Hot Start Master Mix (2X ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA oligonucleotides (RT-qPCR primers) were obtained from Merck (Rehovot, Israel).
-
bioRxiv - Developmental Biology 2023Quote: ... except for a different set of SYBR green primers (Sigma Merck, Supplementary Table 2). The obtained Ct values were analyzed using the ddCt method for relative quantification of mRNA expression derived from three independent experiments ...
-
bioRxiv - Developmental Biology 2021Quote: ... washed in 2 SSC with 0.05% Tween20 (Merck KGaA) at room temperature for 30 seconds ...
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Cell Biology 2023Quote: ... in 2× saline sodium citrate (SSC; Merck, 6132-04-3)) for 5 min at room temperature ...
-
bioRxiv - Genomics 2022Quote: ... followed by quenching with final 1 x Glycine solution for 5 min at RT utilizing the Magna Nuclear RIP (Cross-Linked) Nuclear RNA-Binding Protein Immunoprecipitation Kit (Merck millipore, 17-10520). Cross-linked cells were then centrifuged at 800 x g at 4°C and washed three times with ice cold DPBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 nM 17-β Estradiol (Merck), 10 μM Nicotinamide (Merck) ...
-
bioRxiv - Neuroscience 2023Quote: ... H3K9me2 (1:500) (17-648, Merck), diluted in blocking solution ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... absolute ethanol (Merck: 64-17-5), Oil-red-O (Sigma-Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... ES9-17 (endocytosis inhibitor; 100μM; Merck Millipore) and/or IKK-16 (NFκB inhibitor ...
-
bioRxiv - Molecular Biology 2024Quote: Magna MeRIPTM m6A Kit (17-10499, Merck) was used to enable identification and transcriptome-wide profiling of m6A ...
-
bioRxiv - Cancer Biology 2021Quote: ... and post-fixed in 17 % sucrose buffer (Merck) containing 1 % OsO4 (Roth ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg H3K27me3 antibody (17-622, Merck-Millipore). For quantitative comparison of CTCF binding between WT and CTCF-AID cells ...
-
bioRxiv - Plant Biology 2020Quote: ... Anti-Trimethyl Histone H3K9 antibody (Merck 17-10242), Anti-acetyl Histone H3K27 antibody (Abcam ab4729 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Gene insertion was verified by PCR using the primer pairs pETUpstream/DuetDOWN or DuetUP2/T7 Terminator (Merck) with Enc or mSOG-containing plasmids as template DNA ...
-
bioRxiv - Immunology 2019Quote: ... The inhibition of ADAM-17 (a disintegrin and metalloprotease-17) was performed by adding 8 μM TAPI-1 (Merck Millipore, Burlington, MA). TAPI-1 and MK2 IV were added 60 minutes before cytokine stimulation ...
-
bioRxiv - Genomics 2020Quote: ... were washed in IP-buffer and incubated with 4 μg anti-AP-1 (Thermo Scientific™ #MA5-15172)or anti-Sp1 Ab (ChIPAb+™ Merck #17-601) for 1 h at 4 °C on a rotating wheel ...
-
bioRxiv - Microbiology 2024Quote: ... xylene and absolute ethanol (Merck, CAS-64-17-5) for 10 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: ... phosphatase inhibitor cocktail sets II (Merck) and IV (Merck) ...
-
bioRxiv - Immunology 2020Quote: ... All primers (Merck) were designed to span exon-exon boundaries and are available upon request ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers (Merck, Israel) for mRNA and lncRNA were designed using the NCBI Primer-Blast software ...
-
bioRxiv - Molecular Biology 2019Quote: ... or 4 μg of H3K27me3 antibody (17-622, Merck Millipore).
-
bioRxiv - Microbiology 2019Quote: ... Rabbit polyclonal anti H3K9-me3 (Merck Millipore;Cat#17-625); Rabbit polyclonal H3K36me2 (MerckMillipore ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Anti-Citrulline (Modified) Detection Kit (cat. 17-347B, Merck) was used to measure global citrullination 88 ...
-
bioRxiv - Evolutionary Biology 2023Quote: A Magna RIP Kit (Cat# 17-704, Merck, Millipore, Germany) was used to perform the RIP assay following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2023Quote: A Chromatin Immunoprecipitation (ChIP) Assay Kit (Merck Millipore 17-295) was used for all CTCF ChIP experiments following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with protease inhibitor cocktail set III (Cat No. 539134-1 set, 1:100, Merck Millipore, Rahway, NJ). The lysate was centrifuged at 16,000 g at 4 LJ for 10 minutes to remove insoluble samples ...
-
bioRxiv - Biochemistry 2021Quote: ... protease inhibitor cocktail set III (Merck Millipore), 1 mM PMSF) ...
-
bioRxiv - Biochemistry 2021Quote: ... protease inhibitor cocktail set III (Merck Millipore), 1mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Plant Biology 2020Quote: ... 1X Set III protease cocktail (Merck, 539134), 1 mM NaF ...
-
bioRxiv - Molecular Biology 2019Quote: ... Protease Inhibitor Cocktail Set III (Merck Millipore) and SUPERase• In RNase Inhibitor (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... The sequence-specific primers used are shown in Table S3 (GAPDH and β2M primers were from Eurofins Scientific; other primers were from Merck). The expression levels were normalized to GAPDH and β2M endogenous gene levels ...
-
bioRxiv - Molecular Biology 2019Quote: ... using the primers (Merck) listed in Supplementary table 5 ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR amplification of the Round 1 PCR product (1 ul) with 1 ul of JH reverse primer (10 uM, provided by MERCK) and 1 ul of FR1 forward primer set pools (10 uM per primer ...
-
bioRxiv - Neuroscience 2020Quote: ... Absolute ethanol (CAS Number: 64-17-5) was obtained from Merck KGaA (Darmstadt ...
-
bioRxiv - Neuroscience 2021Quote: ... Absolute ethanol (CAS Number: 64-17-5) was obtained from Merck KGaA (Darmstadt ...
-
bioRxiv - Neuroscience 2021Quote: ... Absolute ethanol (CAS Number: 64-17-5) was obtained from Merck KGaA (Darmstadt ...
-
bioRxiv - Neuroscience 2024Quote: ... Absolute ethanol (CAS Number: 64-17-5) was obtained from Merck KGaA (Darmstadt ...
-
bioRxiv - Cell Biology 2023Quote: ... The allele-specific forward primers and common reverse primers were synthesized by Merck https://www.merckgroup.com/ ...
-
bioRxiv - Molecular Biology 2023Quote: ... The allele-specific forward primers and common reverse primers were synthesized by Merck https://www.merckgroup.com/ ...
-
bioRxiv - Developmental Biology 2022Quote: ... phosphatase inhibitor cocktail sets II and IV (Merck), and phenylmethylsulfonyl fluoride (PMSF ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Synthetic Biology 2020Quote: ... Primers are ordered from Merck Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2019Quote: ... mix with the primers (Merck) listed in Supplementary table 5 ...