Labshake search
Citations for Merck :
1 - 50 of 432 citations for hsa mir 150 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Primers for reverse-transcription PCR (RT-PCR) and quantitative RT-PCR (qRT-PCR) were supplied by Merck with standard desalting at 100 µM in TE buffer ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 1.8 ul of LD forward primer set pools (10 uM per primer, provided by MERCK) using 25 ul of Q5 Hot Start Master Mix (2X ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 1 ul of FR1 forward primer set pools (10 uM per primer, provided by MERCK) using 25 ul of Q5 Hot Start Master Mix (2X ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% HSA (Merck Millipore, 823022), 1% penicillin/streptomycin (Gibco ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA oligonucleotides (RT-qPCR primers) were obtained from Merck (Rehovot, Israel).
-
bioRxiv - Developmental Biology 2023Quote: ... except for a different set of SYBR green primers (Sigma Merck, Supplementary Table 2). The obtained Ct values were analyzed using the ddCt method for relative quantification of mRNA expression derived from three independent experiments ...
-
bioRxiv - Immunology 2023Quote: ... 150 mM NaCl in the presence of Protease inhibitor Cocktail Set III (Calbiochem®, Merck, Darmstadt, Germany) and the phosphatase inhibitor sodium orthovanadate (Sigma-Aldrich ...
-
bioRxiv - Physiology 2019Quote: ... human tubal fluid (HTF) medium and human serum albumin (HSA) (Merck Millipore Corporation ...
-
bioRxiv - Immunology 2023Quote: Carrier proteins (HEL, OVA, HSA, BSA and MSA) were purchased commercially (Merck) and dissolved in 0.1 M NaCO3 (pH = 8 ...
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Developmental Biology 2023Quote: ... The digestion was terminated by α-MEM media with 10% HSA (Merck Millipore, 823022). After digestion ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Gene insertion was verified by PCR using the primer pairs pETUpstream/DuetDOWN or DuetUP2/T7 Terminator (Merck) with Enc or mSOG-containing plasmids as template DNA ...
-
bioRxiv - Genomics 2022Quote: ... 150 mM LiCl (Merck), 1 mM EDTA ...
-
bioRxiv - Pathology 2022Quote: ... 150 mM NaCl (Merck), 5 mM EDTA (Merck) ...
-
bioRxiv - Neuroscience 2019Quote: 150 mM NaCl (Merck), 15 mM sodium citrate (Merck) ...
-
bioRxiv - Physiology 2023Quote: ... cells or tissues were lysed in RIPA buffer (50 mM Tris pH 8 (Merck),150 mM NaCl (Merck), 5 mM EDTA (Merck) ...
-
bioRxiv - Cell Biology 2023Quote: ... 150 mM NaCl (Merck), 5 mM EDTA (Merck) ...
-
bioRxiv - Developmental Biology 2020Quote: ... phosphatase inhibitor cocktail sets II (Merck) and IV (Merck) ...
-
bioRxiv - Immunology 2020Quote: ... All primers (Merck) were designed to span exon-exon boundaries and are available upon request ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers (Merck, Israel) for mRNA and lncRNA were designed using the NCBI Primer-Blast software ...
-
bioRxiv - Cell Biology 2020Quote: ... and 150 μM LAAP (Merck). Medium was replaced every other day ...
-
bioRxiv - Developmental Biology 2023Quote: ... 150 µM ascorbic acid (Merck), 55 µM β-mercaptoethanol (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2023Quote: ... LARP4B (Merck, HPA036566, 1:150), TOM20 (Santa Cruz ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with protease inhibitor cocktail set III (Cat No. 539134-1 set, 1:100, Merck Millipore, Rahway, NJ). The lysate was centrifuged at 16,000 g at 4 LJ for 10 minutes to remove insoluble samples ...
-
bioRxiv - Biochemistry 2021Quote: ... protease inhibitor cocktail set III (Merck Millipore), 1 mM PMSF) ...
-
bioRxiv - Biochemistry 2021Quote: ... protease inhibitor cocktail set III (Merck Millipore), 1mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Plant Biology 2020Quote: ... 1X Set III protease cocktail (Merck, 539134), 1 mM NaF ...
-
bioRxiv - Molecular Biology 2019Quote: ... Protease Inhibitor Cocktail Set III (Merck Millipore) and SUPERase• In RNase Inhibitor (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... The sequence-specific primers used are shown in Table S3 (GAPDH and β2M primers were from Eurofins Scientific; other primers were from Merck). The expression levels were normalized to GAPDH and β2M endogenous gene levels ...
-
bioRxiv - Molecular Biology 2019Quote: ... using the primers (Merck) listed in Supplementary table 5 ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR amplification of the Round 1 PCR product (1 ul) with 1 ul of JH reverse primer (10 uM, provided by MERCK) and 1 ul of FR1 forward primer set pools (10 uM per primer ...
-
bioRxiv - Cell Biology 2023Quote: ... The allele-specific forward primers and common reverse primers were synthesized by Merck https://www.merckgroup.com/ ...
-
bioRxiv - Molecular Biology 2023Quote: ... The allele-specific forward primers and common reverse primers were synthesized by Merck https://www.merckgroup.com/ ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-Sox2 (1:150, Merck; Ab5603), anti-Iba1 (1:500 ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-NeuN (1:150, Merck; MAB377) and ...
-
bioRxiv - Cell Biology 2023Quote: ... 150 mM NaCl (Merck Life science), 2 mM MgCl2 (Merck Life science) ...
-
bioRxiv - Cell Biology 2023Quote: ... or 150 nM Aphidicolin (APH; Merck) for 6 days ...
-
bioRxiv - Cancer Biology 2023Quote: ... 150 mM NaCl (Merck, Cat#106404), pH 8 ...
-
bioRxiv - Developmental Biology 2022Quote: ... phosphatase inhibitor cocktail sets II and IV (Merck), and phenylmethylsulfonyl fluoride (PMSF ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Synthetic Biology 2020Quote: ... Primers are ordered from Merck Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2019Quote: ... mix with the primers (Merck) listed in Supplementary table 5 ...
-
bioRxiv - Biochemistry 2023Quote: ... Primers were obtained from Merck or Eurofins Genomics ...
-
bioRxiv - Cell Biology 2020Quote: ... 150 × 2.1 mm (Merck SeQuant, Darmstadt, Germany) at a flow rate of 300 μL/min ...
-
bioRxiv - Biochemistry 2021Quote: ... in RIPA buffer (150 mM NaCl (Merck), 5 mM EDTA (Merck) ...
-
bioRxiv - Molecular Biology 2019Quote: ... supplemented with Protease Inhibitor Cocktail Set III (Merck Millipore), mixed by rotation at 4°C for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... complemented with protease inhibitor cocktail set III (Merck Millipore) and phosphatase inhibitor cocktail II (AG Scientific) ...