Labshake search
Citations for Merck :
1 - 50 of 201 citations for Ub Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... K48-Ub linkage (MERCK, 05-1307), Phosphothreonine (Cell Signaling ...
-
bioRxiv - Biochemistry 2023Quote: ... rabbit monoclonal K63-specific Ub (Apu3) (Merck, 05-1308), and rabbit monoclonal K48-specific Ub (Apu2 ...
-
bioRxiv - Biochemistry 2023Quote: ... and rabbit monoclonal K48-specific Ub (Apu2) (Merck, 05-1307). The following secondary antibodies were used ...
-
bioRxiv - Biochemistry 2024Quote: ... Dissolved IntC-UbcH5c-CAET-Ub was transferred to a dialyzer (D-Tube Dialyzer Maxi, MWCO 6– 8 kDa, Merck) in 300 mL of unfolding buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... Peptide-18 (Merck Millipore) was recovered in water at a stock concentration of 1 mg/ml and microinjected in the oocyte cytoplasm.
-
bioRxiv - Zoology 2021Quote: C-peptide and glucocorticoid levels were determined using a radioimmunoassay (Human C-Peptide, Merck Millipore ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1% Blocking Reagent (BR, Merck 11096176) and 10% goat serum ...
-
bioRxiv - Developmental Biology 2022Quote: ... and blocking with donkey serum (Merck). Following incubation with primary and secondary antibodies (Supplementary file 4) ...
-
bioRxiv - Cell Biology 2022Quote: mRFP was amplified from aleu-mRFP (65) using GAGGACGTCGACATGGCCTCCTCCGAGGACGTCATCA/ GTCCTCACTAGTTTATGCTCCAGTACTGTGGCGGCCC and inserted into the second multiple cloning site of PSF- CMV-CMV-SBFI-UB-PURO (Merck, #OGS597-5UG) using SalI/SpeI restriction digest and ligation ...
-
bioRxiv - Neuroscience 2023Quote: ... Digested peptides were desalted using ZipTips (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Blocking was done with 10% donkey serum (Merck). Primary antibody (S139 ...
-
bioRxiv - Microbiology 2022Quote: ... blocked with 10% Western Blocking Reagent (Merck; 11921673001)/PBSDT ...
-
bioRxiv - Neuroscience 2024Quote: ... Blocking solution containing 10% donkey serum (Merck, D9663), 5% BSA (Millipore,821006) ...
-
bioRxiv - Plant Biology 2019Quote: ... Peptide pellets were dissolved in ITC-buffer and peptide concentrations were assessed by FTIR with a DirectDetect system (Merck). Protein concentrations of the receptor domains were measured by absorption at 280 nm and calculated by their molar absorption coefficient at 280 nm ...
-
bioRxiv - Bioengineering 2020Quote: ... 50 µl blocking buffer (10% goat serum (Merck G9023) and 0.1% Triton X-100 in PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... Blocking was completed via incubation with 5% BSA (Merck) solution for 1 hour followed by overnight incubation at 4°C with 1:100 dilutions of DNA labelled anti-P2Y2 ...
-
bioRxiv - Microbiology 2023Quote: ... before blocking with 1% bovine serum albumin (BSA) (Merck) in PBS supplemented with 4 µg/mL free streptavidin ...
-
bioRxiv - Cancer Biology 2021Quote: ... EV peptides were de-salted using ZipTips (Merck) according to the manufacturer’s directions.
-
bioRxiv - Cell Biology 2023Quote: ... which were eluted FLAG® peptide (Merck-SIGMA) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... 500 μg/mL FLAG® peptide (Merck; F3290)) were added to the beads ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were then blocked in blocking buffer [1% gelatin (Merck), 1% BSA (Merck) ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by blocking with 2% BSA solution (Merck Life science) in PBS ...
-
bioRxiv - Cell Biology 2020Quote: Peptides were resuspended in 2% (v/v) acetonitrile (Merck), 0.1% (v/v ...
-
bioRxiv - Biochemistry 2022Quote: ... Digested peptides purified using a ZipTip C18 (Merck Millipore) were analyzed by LC-MS/MS on an Orbitrap Fusion Tribrid (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... peptide mixtures were desalted using ZipTips C18 (Merck Millipore), vacuum dried and resuspended in 0.1% formic acid ...
-
bioRxiv - Immunology 2023Quote: ... The peptide mixture was acidified with trifluoroacetic acid (Merck) to a final concentration of 1% ...
-
bioRxiv - Immunology 2023Quote: ... the peptides were cleaned using C18 ZipTip® (Merck Millipore ...
-
bioRxiv - Immunology 2022Quote: Sequences for Mtb proteins Rv1196 and Rv0125 were obtained from publicly available databases and peptide libraries were generated using a commercially available peptide library design tool (PEPscreen, Millipore Sigma, Merck, Darmstadt, Germany) with peptide lengths of 20 amino acids (a.a. ...
-
bioRxiv - Developmental Biology 2021Quote: ... and then blocked in 1.5% Roche blocking reagent (11096176001, Merck & Co.) for more than an hour ...
-
bioRxiv - Biophysics 2023Quote: ... or anti-integrin blocking β2 (CD18) antibody (Merck, cat. no. CBL158), and the corresponding IgG1 isotype (rndsystems ...
-
Human immunodeficiency virus-1 induces and targets host genomic R-loops for viral genome integrationbioRxiv - Molecular Biology 2024Quote: ... The cells were then blocked with 1× blocking solution (Merck, DUO92102) for 1 h at 37°C in a humidity chamber ...
-
bioRxiv - Molecular Biology 2023Quote: ... a blocking step using 5% Donkey-serum (Merck, cat.no: D9663-10ML) in PBS for 15 minutes was performed ...
-
bioRxiv - Microbiology 2020Quote: ... peptides were desalted using C18 ZipTips (Merck Millipore, Darmstadt, Germany) according to the manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... the peptide cocktail solved in 33% DMSO (Dimethyl sulfoxide, Merck) and Montanide ISA™51 is defrozen for ten minutes ...
-
bioRxiv - Neuroscience 2019Quote: ... and rabbit anti-2A peptide (Merck Millipore ABS31, 1:2000). All corresponding secondary antibodies were from ThermoFisher/Life technologies or Jackson ImmunoResearch laboratories ...
-
bioRxiv - Physiology 2019Quote: ... Peptides were bound and desalted using C18 ZipTips (Merck Millipore) and washed with 0.1% trifluoroacetic acid (TFA ...
-
bioRxiv - Cell Biology 2020Quote: ... Peptides were then purified using a C18 ZipTip (Merck Millipore). Eluted peptides were dried in a SpeedVac and resuspended in 10 µL of 0.1 % formic acid ...
-
bioRxiv - Systems Biology 2020Quote: ... Peptides were eluted in varying concentrations of ammonium acetate (Merck). The eluted peptides were dried using speedvac concentrator.
-
bioRxiv - Neuroscience 2021Quote: ... Hexokinase II VDAC Binding Domain Peptide (Hkp, 2.5uM; Merck, 376816) or vehicle (water solvent ...
-
bioRxiv - Biophysics 2021Quote: The peptide inhibitor (decanoyl-RVKR-cmk) was purchased from Merck-Millipore (Billerica ...
-
bioRxiv - Biochemistry 2020Quote: ... Tryptic peptides were successively extracted with 5 % formic acid (Merck)/50 % acetonitrile (Merck) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The peptides were desialylated in 50 mM sodium acetate (Merck) buffer pH 5 using Clostridium perfringens neuraminidase (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: Peptide samples were acidified by adding 1 % trifluoroacetic acid (Merck) and debris pelleted by centrifugation for 5 minutes at 14 000 × g ...
-
bioRxiv - Molecular Biology 2022Quote: ... The resulting peptides were desalted using C18 ziptips (Merck ZTC04S096) and sent for MS analysis.
-
bioRxiv - Cancer Biology 2019Quote: ... β1 Integrin blocking antibody (clone AIIB2) and control isotype were from Merck Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... After blocking for 2h in 10 % normal goat serum (NGS, Merck Millipore) and 0.5 % Triton (AppliChem ...
-
bioRxiv - Cell Biology 2021Quote: ... and were consecutively eluted by competition using FLAG peptide (#F3290, Merck). For immunoblot analysis ...
-
bioRxiv - Microbiology 2021Quote: ... The eluted peptides were desalted using ZipTip-μC18 material (Merck Millipore) and dissolved in 0.1% (v/v ...
-
bioRxiv - Biophysics 2020Quote: The solution of peptides was then acidified with Trifluoroacetic acid (Merck) to a final concentration of 1% and a pH value of < 2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Peptides were Gly-Arg-Gly-Asp-Ser-Pro (GRGDSP, Merck, SCP0157) and scramble control Gly-Arg-Ala-Asp-Ser-Pro (GRADSP ...