Labshake search
Citations for Merck :
1 - 50 of 216 citations for Recombinant Autographa Californica Multiple Nucleopolyhedrovirus Lysate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... Aplysia californica ADP ribosyl cyclase was purchased from Merck (A8950), resuspended at 1 mg/ml in Tris/HCl 50mM ...
-
bioRxiv - Biochemistry 2020Quote: ... Cell lysates were supplemented with 500 U Recombinant DNAse (Merck 4716728001) and 100 mM PMSF ...
-
bioRxiv - Neuroscience 2023Quote: ... after testing multiple antibodies (anti-NeuN rabbit Antibody, ABN78 & ABN78C3, Merck; anti-NeuN rabbit Antibody ...
-
bioRxiv - Plant Biology 2021Quote: Multiple rounds of sequential extraction (initially by hexane/dichloromethane (1:1 v/v) (Merck, Germany ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant BG4 (recBG4) (Millipore Merck) was added as control.
-
bioRxiv - Molecular Biology 2020Quote: ... lysates (including phosphatase inhibitors (Merck) in the case of the quantitative γH2A-assay ...
-
bioRxiv - Cell Biology 2021Quote: ... human recombinant insulin (100 µg/mL; Merck), recombinant human insulin-like growth factor 1 (hIGF1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Recombinant human TNFα (GF023) was from Merck. Purified anti-His tag mouse antibody was from BioLegend (USA) ...
-
bioRxiv - Immunology 2020Quote: ... Collected proteins were buffer exchanged into PBS via multiple rounds of centrifugation in 10 kDA ultrafiltration tubes (Merck, USA). The purified protein content was measured by Bradford assay (B6916 ...
-
bioRxiv - Pathology 2022Quote: ... recombinant anti-Cre (Merck Millipore, 69050, 1:1000) and revealed using Histofine reagent (Nichirei Biosciences) ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant active DAPK3 protein was obtained from Merck.
-
bioRxiv - Microbiology 2022Quote: ... A PgVV-only lysate was obtained by 0.2 µm filtering of a mixed lysate (Millex, SLGV033RS, Merck Millipore), TFF concentration (Repligen N06-E100-05-N ...
-
bioRxiv - Biophysics 2021Quote: ... and multiple holes were made in the PF Gel-Film using a Harris unicore punch (diameter, 2.5 mm; Merck, Darmstadt). Then the piece of PF Gel-Film was put into the center of a sterile cell culture dish (FluoroDish FD35-100 ...
-
bioRxiv - Biophysics 2019Quote: ... The excess monomeric species was removed by multiple filtration using a 100 kDa cutoff centricon (Amicon, Merck Millipore, MA, USA) to enrich the population of the oligomeric species ...
-
bioRxiv - Microbiology 2019Quote: ... pH 7.4) through multiple dilution and centrifugation steps using Amicon Ultra-15 centrifugal filters (10 kDa cuttoff, Merck Millipore, Germany). Protein purity was estimated with SDS-PAGE and the concentration determined with the Pierce BCA assay kit (Thermo Scientific ...
-
bioRxiv - Biophysics 2022Quote: ... Buffer was changed to 1Xpbs (Biological Industries, Israel) using multiple washes on Amicon ultra-2 columns (Merck, Burlington, MA #UFC203024).
-
bioRxiv - Biochemistry 2022Quote: ... using primers listed in Table S1 and cloned into two tandem multiple cloning sites of pET-Duet vector (Novagen, Merck), using the restriction enzymes BamHI and SalI for MjFHα subunit ...
-
bioRxiv - Molecular Biology 2021Quote: ... protein lysates were reduced with dithiothreitol (Merck) and cysteine residues were alkylated with iodoacetamide (Merck) ...
-
bioRxiv - Biophysics 2021Quote: ... 6×His-tagged recombinant MSP1E3D1 (Sigma-Aldrich, Merck, USA) and FLAG-tagged recombinant mCardinal (kindly provided by Jakub Czapiński ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 2 μg/ml of recombinant TNC (Merck Millipore) added to the medium ...
-
bioRxiv - Immunology 2021Quote: ... recombinant hepatitis B surface antigen (HBsAg) manufactured by Merck & Co. ...
-
bioRxiv - Biophysics 2020Quote: ... Recombinant DNA reagents and primers were purchased from Merck. As calibration samples in ALEX as well as anisotropy experiments ...
-
bioRxiv - Developmental Biology 2022Quote: ... 10 mg/mL Human recombinant Insulin (Merck, Cat. #91077C) and 1% Pen/Strep ...
-
bioRxiv - Neuroscience 2023Quote: ... Tau ladder (six human tau recombinant isoforms, Sigma-Merck) was used to identify tau isoforms in NCI-H716 cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.1 IU/ml recombinant human FSH (Merck & Co., Inc), 0.125 mg/ml recombinant human hyaluronan (Novozymes) ...
-
bioRxiv - Biochemistry 2023Quote: ... Active recombinant LKB1/STRADα/MO25α was purchased from Merck. Gateway pENTR plasmids encoding full length human BRSK1 & BRSK2 were generated as part of the NIH common fund initiative to Illuminate the Druggable Genome (IDG ...
-
bioRxiv - Cell Biology 2021Quote: ... The following siRNA sequences were used: Control siRNA: endoribonuclease-prepared siRNA pool (esiRNA) that that target multiple locations in the EGFP mRNA sequence (Merck; EHUEGFP), E1B-55k siRNA (I) ...
-
bioRxiv - Zoology 2020Quote: ... filled with a mixture of plaster of Paris (Siniat-Prestia, multiple purpose plaster) and charcoal (CAS 7440-44-0, Merck, Germany) (500g plaster of Paris ...
-
bioRxiv - Biochemistry 2020Quote: For bacterial protein expression the coding sequences of all BphPs used in the study except RpBphP1 were PCR amplified as a NdeI/XhoI fragment and cloned into the second multiple cloning site of pET-Duet1 vector (Novagene, Merck Millipore). RpBphP1 was PCR amplified as a Nde/Pac1 fragment and cloned into the second multiple cloning site of pET-Duet1 vector Additionally ...
-
bioRxiv - Cell Biology 2022Quote: mRFP was amplified from aleu-mRFP (65) using GAGGACGTCGACATGGCCTCCTCCGAGGACGTCATCA/ GTCCTCACTAGTTTATGCTCCAGTACTGTGGCGGCCC and inserted into the second multiple cloning site of PSF- CMV-CMV-SBFI-UB-PURO (Merck, #OGS597-5UG) using SalI/SpeI restriction digest and ligation ...
-
bioRxiv - Cell Biology 2024Quote: ... of cell lysates by incubating lysates with 0.5-2.5 µg of antibodies and 20 µl of protein G–Sepharose (Merck, GE17-0618-01) at 4°C for 2 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... protocol with the administration of recombinant FSH (Gonal-F, Merck Serono ...
-
bioRxiv - Genetics 2020Quote: ... then rhCG (recombinant human chorionic gonadotropin alpha, OVIDREL, Merck Serono) on day 9 Oocytes were collected by laparoscopic follicular aspiration 32–35 h after rhCG administration ...
-
bioRxiv - Biochemistry 2021Quote: ... A complex of recombinant bovine CaM (cat. no. 208690, Merck), with an amino acid sequence identical to the human isoform ...
-
bioRxiv - Developmental Biology 2021Quote: ... Patients were injected with recombinant FSH (Gonal-F, Merck, Italy) on day 2 of their menstrual cycle with a starting dose of 150 IU/d ...
-
bioRxiv - Immunology 2020Quote: ... and recombinant human RAP (Merck Millipore, 200 nM final concentration) were used to stimulate nuclear translocation of MerTK.
-
bioRxiv - Biophysics 2022Quote: Lyophilized recombinant human Chorionic Gonadotropin (hCG) (Chorulon Merck #140-927) is reconstituted with the included sterile 1x PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... of the following ECM proteins: recombinant human fibronectin (Merck, 341631), recombinant human vitronectin (PeproTech ...
-
bioRxiv - Cell Biology 2023Quote: ... Treatments used recombinant human TNFα (10 ng/ml; Merck 654245) and/or LMB (20 ng/ml ...
-
bioRxiv - Genomics 2020Quote: ... An amount of 35 or 40 μg whole cell lysates or tissue lysates were resolved by 10% SDS-PAGE and transferred onto PVDF membranes (Merck Millipore, Germany). After incubation in 5% non-fat milk for 1 h at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nuclear lysates were treated with Benzonase (Merck-Millipore, 70664). Nuclear lysates were pre-cleared on 25 μL Dynabeads M-280 Sheep anti-mouse or antirabbit IgG (Thermo ...
-
bioRxiv - Cancer Biology 2023Quote: Protein lysates were prepared using RIPA buffer (Merck/Millipore). SDS-PAGE and western blotting were performed using standard protocols ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 75 mIU/mL of recombinant follicle stimulating hormone (Merck Serono). The oocytes were randomly assigned to experimental groups ...
-
bioRxiv - Biochemistry 2022Quote: ... Standard curves were generated using recombinant HIV-1 RT (Merck Millipore). The relative viral quantities were calculated based on the standard curve generated using QuantStudio-7 systems software (Applied Biosystems).
-
bioRxiv - Genomics 2019Quote: ... and 100 Units/ml of Recombinant mouse LIF Protein (Merck ESG1107). Culture were seeded at an average density of ∼ 3.8*104 cells/cm2 and passaged every 48 h.
-
bioRxiv - Biochemistry 2022Quote: ... 1000 U/mL recombinant leukemia inhibitory factor (LIF/ESGRO) (Merck Millipore) and 50 U/mL Penicillin–Streptomycin (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2020Quote: ... ESGRO recombinant mouse Leukaemia Inhibitory Factor (LIF) was obtained from Merck Millipore ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant rabbit anti-pan-ADP-ribose binding reagent MABE1016 (Merck Millipore) was used 1:1000 ...
-
bioRxiv - Genomics 2020Quote: ... 1000 U/ml recombinant leukemia inhibitory factor (LIF/ESGRO) (Merck Millipore), and 50U/ml Penicillin/Streptomycin (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... recombinant FSH (Gonal-f 75 UI, Merck Serono Europe Limited, Spain), urinary human menopausal gonadotropin (hMG ...