Labshake search
Citations for Merck :
1 - 50 of 3257 citations for RGPD1 2 3 4 5 8 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... followed by 3 PBS washes and blocking with 5% bovine serum albumin (BSA; Merck) for 1 hour ...
-
bioRxiv - Developmental Biology 2023Quote: ... and left overnight at 4°C in blocking solution containing 3% Donkey Serum (D9663, Merck) and 0.03% Sodium Azide (40-2000-01 ...
-
bioRxiv - Neuroscience 2021Quote: ... This was followed by a 3 h blocking step with 5 % NGS (G9023, Merck, Darmstadt Germany) in the respective washing buffer ...
-
bioRxiv - Microbiology 2022Quote: ... 2-heptyl-3- hydroxy-4(1H)-quinolone (PQS) (Sigma Aldrich, Merck Life Science ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Neuroscience 2023Quote: ... and stained with 5 µM 4′,6-diamidino-2-phenylindole (DAPI) (Merck) in PBS if required ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Blocking was completed via incubation with 5% BSA (Merck) solution for 1 hour followed by overnight incubation at 4°C with 1:100 dilutions of DNA labelled anti-P2Y2 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 20 μl, 5 mg/ml, Merck) was added to each well ...
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2020Quote: Peptides were resuspended in 2% (v/v) acetonitrile (Merck), 0.1% (v/v ...
-
bioRxiv - Biochemistry 2020Quote: ... Tryptic peptides were successively extracted with 5 % formic acid (Merck)/50 % acetonitrile (Merck) ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by blocking with 2% BSA solution (Merck Life science) in PBS ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: When the tumor sizes reached to 80 mm3 animals were treated with a PFKFB3 inhibitor 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one) (3PO) (Sigma-Aldrich, Merck, Overijse, Belgium). The animals received intraperitoneal (i.p. ...
-
bioRxiv - Molecular Biology 2023Quote: ... a blocking step using 5% Donkey-serum (Merck, cat.no: D9663-10ML) in PBS for 15 minutes was performed ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 x 3’ Neoclear (Merck), 2 x 3 ‘ 100% ETOH ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ cyclic mono-phosphate (8-Br-cAMP, Merck B5386) and 1 μM medroxyprogesterone acetate (MPA ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Physiology 2021Quote: ... Membranes blocked with 5% non-fat milk in PBS-T or Tris-Buffered Saline TBS (TBS-T) (RT, 60min) and immunoblotted using the following primary antibodies (4°C, overnight): rabbit anti-pSmad1/5/8 (Merck Millipore, AB3848), rabbit anti-pSmad2 (Cell Signaling ...
-
bioRxiv - Neuroscience 2020Quote: ... the plate was blocked with blocking buffer (3% BSA (Merck Millipore, MA, USA 820451) in PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... 4-amino pyridine (5 mM, Merck) and TTX (0.5-1 μM ...
-
bioRxiv - Bioengineering 2020Quote: ... Following PBS washes (5 min x3) and overnight incubation in blocking buffer (5% bovine serum albumin (Merck Millipore) in PBS ...
-
bioRxiv - Biophysics 2022Quote: ... and blocking them with 5 w/v% bovine serum albumin (BSA, Merck KGaA), both diluted in PBS for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL lipid extract was injected on a LiChroCART 250–4 LiChrospher® Si 60 (5 μm) (Merck) maintained at 25 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and blocked in blocking solution (4 % (w/v) skim milk powder (Merck, #70166-500G) and 1 % (w/v ...
-
bioRxiv - Neuroscience 2020Quote: ... They were cut into 250μm parasagittal slices using a McIlwain tissue chopper and the slices placed on Millicell membrane (3-4 slices per membrane, 2 membranes per animal, 0.4 μm Millicell, Merck Millipore) in 50% BME (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The lysate was supplemented with calcium chloride to a final concentration of 3 mM and chromatin was solubilised for 2 h at 4 °C by digestion with Turbonuclease (T4330, Merck) to a final concentration of 250U/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... Nonspecific antibody blocking was for 1 h with 2% bovine serum albumin (Merck) in Tris-buffered saline ...
-
bioRxiv - Microbiology 2024Quote: ... and mixed 4 g of it in 8 mL of DMSO (Merck). The DMSO-soluble fraction of Enteropan was found to be 71.17% ± 3.07 ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... After blocking for one hour in PBST with 5% normal goat serum (Merck G9023) and 0.1% BSA ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Biophysics 2019Quote: ... Fragments (2 mM in DMSO) were injected (2 μL) onto a Purospher STAR RP-18 end-capped column (3 μm, 30 × 4 mm, Merck KGaA). Chromatographic separation was carried out over a 4-min gradient elution (90:10 to 10:90 water:methanol ...
-
bioRxiv - Cell Biology 2023Quote: ... The blots were developed in a solution of nitroblue tetrazolium chloride (NBT) and 5-brom-4-chlor-3-indoxylphosphate (BCIP; Merck, Darmstadt, Germany) for 5–30 min at RT ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting peptides were extracted in 70% ethanol plus 5% formic acid (Merck-Millipore) twice for 20 min with permanent shaking ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were mounted in CitiFluor™ CFM3 mounting medium (proSciTech, Australia) containing 3 μg/uL 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Merck, Germany) to stain nucleic acids ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... peptides (<3 kDa) were separated from high molecular size proteins by a 3 kDa cutoff ultrafiltration column (Amicon®, Merck Millipore Ltd., Cork, Ireland). The crude peptides (<3 kDa ...
-
bioRxiv - Biochemistry 2022Quote: The matrix 2′,5′-dihydroxyacetophenone (DHAP; Merck) was applied by sublimation and the data were acquired on a modified timsTOF fleX instrument (Bruker Daltonics ...