Labshake search
Citations for Merck :
1 - 50 of 111 citations for PCR strip since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... with pH indicator strips (Merck, 109535). Collagen I solution preparation was performed on ice with all reagents pre-chilled to 4°C ...
-
bioRxiv - Genomics 2019Quote: ... and an anaerobic indicator strip (Anaerotest, Merck Millipore) to record the strict maintenance of the anaerobic atmosphere ...
-
bioRxiv - Genomics 2021Quote: ... and [F] using MQuant® test strips (Merck). Where [F] was at the upper detection limit of the test strips ...
-
bioRxiv - Microbiology 2021Quote: ... moscoviensis cells from a membrane bioreactor were harvested and washed until no nitrite or nitrate was detectable via nitrite/nitrate test strips (Nitrite test strips MQuant®, Merck) (see above) ...
-
bioRxiv - Microbiology 2021Quote: ... This was repeated until no nitrite or nitrate was detectable via nitrite/nitrate test strips (Nitrite test strips MQuant®, Merck) in the culture ...
-
bioRxiv - Microbiology 2022Quote: ... and oxidase activity was determined using oxidase strips (Merck). Bacterial growth was evaluated on CM agar plates with different NaCl concentrations (0.5 - 5% (w/v ...
-
bioRxiv - Genomics 2023Quote: ... and residual formaldehyde concentration ([F]) using MQuant test strips (Merck). From visually well-preserved specimens within jars registering neutral pH (6 > pH < 8 ...
-
bioRxiv - Microbiology 2019Quote: ... pH values were measured using Neutralit indicator strips (Merck, Darmstadt, Germany). Flow/discharge rate of hot water at the vent (HTP ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... some strips were stimulated with NADPH (100 μM; Merck, Darmstadt, Germany) and 4-TEMPOL (1 mM ...
-
bioRxiv - Cell Biology 2019Quote: ... The seminal pH was measured with a pH strip (Merck Pharmaceuticals, Darmstadt, Germany).
-
bioRxiv - Neuroscience 2021Quote: ... These flat-mounted strips were fixed in 3% paraformaldehyde (Sigma-Aldrich, Merck, St Louis, USA) with 1.5% glutaraldehyde (Ted Pella ...
-
bioRxiv - Microbiology 2022Quote: ... pH measurements of the solid media were done using pH-indicator strips (MQuant®, Merck).
-
bioRxiv - Plant Biology 2022Quote: ... and the pH of the agar was 6.0 (pH indicator strips, Merck, Buenos Aires, Argentina). At the beginning of the photoperiod of day 3 (25 h before the beginning of shade treatments) ...
-
bioRxiv - Cell Biology 2023Quote: ... The collected tissues were cut into thin strips before incubation with Dispase (CLS354235, Merck, Darmstadt, Germany) for 20 min at 37°C ...
-
bioRxiv - Systems Biology 2020Quote: ... Nitrite concentrations in the effluent were always below detection limit (nitrite test strips MQuant, Merck, Darmstadt, Germany). Anoxic conditions were maintained via continuous sparging with Ar/CO2 (95%/5% v/v ...
-
Gpr125 identifies myoepithelial progenitors at tips of lacrimal ducts and is essential for tear filmbioRxiv - Developmental Biology 2020Quote: ... 35mm x 5mm wide commercial Schirmer Tear Test standardized sterile strips (Schirmer Tear Test; Merck Animal Health) were transected with into two 15mm x 2.5mm strips ...
-
bioRxiv - Bioengineering 2023Quote: ... Nitrite and nitrate concentrations were additionally checked using semi-quantitative colorimetric strips (110007 and 110020 MQuant, Merck). The acid-base equilibria of HNO2 and NO - ...
-
bioRxiv - Microbiology 2020Quote: ... Nitrite concentrations were checked daily to ensure nitrite-limited conditions (Nitrite test strips MQuant®, Merck, Darmstadt, Germany).
-
bioRxiv - Microbiology 2020Quote: ... NO2- concentrations were determined using colorimetric test strips (NO2--test, 0-10 mgNO2-N·L-1, Merck KGaA, Darmstadt, Germany).
-
bioRxiv - Microbiology 2020Quote: pH measurements of the culture medium after 72h incubation were done directly after taking the samples out of the incubator using pH-indicator strips (Merck, Germany) for the Transwell® inserts samples ...
-
bioRxiv - Microbiology 2021Quote: ... the reactor was checked daily for general parameters including pH with an Applisense electrode (Applikon, Delft, The Netherlands) and nitrate and nitrite concentrations with MQuantTM colorimetric test strips (Merck, Darmstadt, Germany). During experimental conditions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: CC strips were dissected and then transferred to microtiter plate wells containing 5 μM bis-N-methylacridinium nitrate (Lucigenin; Merck, Darmstadt, Germany), some strips were stimulated with NADPH (100 μM ...
-
bioRxiv - Microbiology 2021Quote: ... Nitrite and nitrate concentrations were check daily to ensure all nitrite was consumed stoichiometrically to nitrate (Nitrite test strips MQuant®, Merck, Darmstadt, Germany) and that nitrite was always limiting ...
-
bioRxiv - Microbiology 2021Quote: Colorimetric pH measurement was performed for 12 independent pancreatic juice samples by applying 1 µL sample onto MColorpHast™ pH strips (Merck Millipore, MA, USA). To adjust the pH of pancreatic juice ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers for reverse-transcription PCR (RT-PCR) and quantitative RT-PCR (qRT-PCR) were supplied by Merck with standard desalting at 100 µM in TE buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR was performed using REDTaq® ReadyMix™ PCR Reaction Mix (R2523, Merck-SIGMA) using previously published primers (Charalambous et al ...
-
bioRxiv - Immunology 2021Quote: ... The PCR product was gel purified (Illustra™ GFX PCR DNA and Gel Band Purification Kit, Merck) and used as template for in vitro transcription using the MEGAscript T7 Transcription Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2019Quote: ... PCR was performed using KOD polymerase (Merck). Samples were pooled across sub-amplicons and prepared for sequencing using NebNext Ultra II (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD polymerase (Merck) and the following primers (GTCTTGGTCATAGACACTGGTAG and GGCTGTTTAATAGGGGCTGAAC ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD polymerase (Merck) and the following primers (CAACTTACTCCTACTTGGCGT and XXXXTGCGTTGATACCACTGCTTT ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time quantitative PCR was performed using 5uL of KAPA Sybr Fast Universal 2x PCR master mix (Merck, #KK4601), 0.6uL of 5 uM forward primer ...
-
bioRxiv - Microbiology 2021Quote: ... PCR grade water (Lichrosolv®; Merck, Darmstadt, Germany). The qPCR was performed in triplicates using the CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Genomics 2022Quote: ... contained in the Kap2G Robust PCR kit (MERCK) per sample and 9 μl added to each well need to be used in a 96-well plate ...
-
bioRxiv - Cell Biology 2023Quote: ... or Power SYBR Green PCR Master Mix (Merck). For all groups ...
-
bioRxiv - Genomics 2023Quote: ... PCR reactions were conducted using KAPA Taq (Merck) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... The PCR product was cloned into pFLAG-CMV5a (Merck) using restriction enzymes Bam HI and Kpn I ...
-
bioRxiv - Zoology 2022Quote: ... 6 μL 2X Kappa2G Fast PCR Ready Mix (Merck, Germany). Primer concentrations and volumes differed between the multiplex assays and are detailed in Table S1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Integration fragments were generated by PCR using KOD polymerase (Merck) from standard vectors pUC19-EmFP ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD Hot Start DNA polymerase (Merck). PCR products were purified using the Monarch PCR and DNA Cleanup Kit (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: The REDExtract-N-Amp™ Tissue PCR Kit (Merck, XNAT) was used for genotyping for all tissue explants ...
-
bioRxiv - Cell Biology 2024Quote: ... PCRs were performed with KOD hot-start polymerase (Merck #71086), using primers flanking the gRNA recognition site ...
-
bioRxiv - Microbiology 2021Quote: ... and PCR of the spike was performed using KOD polymerase (Merck). For next generation sequencing RNA from virus-containing samples were extracted using the QIAsymphony DSP Virus/Pathogen mini kit (Qiagen) ...
-
bioRxiv - Bioengineering 2020Quote: ... AGPAT1 was then amplified by PCR with KOD DNA polymerase (Merck) using primer pair 5’-CACCATGGATTTATGGCCTGGTGC-3’ & 5’-TCATCCTCCTCCACCTGG-3’ ...
-
bioRxiv - Genomics 2022Quote: ... Plasmid concentrations were measured by quantitative PCR with SYBR green (Merck) and primers annealing to the origin of replication site of the PCUP1-Sup35N-Aß42 plasmid at 58 C for 40 cycles (primers MS_05-06 ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR products were ligated into the plasmid pET24a (+) (Merck, Germany) at NdeI/XhoI restriction sites ...
-
bioRxiv - Genomics 2021Quote: ... we added 15μL PCR mix containing 12.5μL KAPA HiFi HS mastermix (Merck), 0.25μL 10μM Smart-seq2 ISPCR primer (SigmaAldrich ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCR amplification was performed by KOD Hot Start DNA polymerase (Merck Millipore). All enzymes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCR amplifications were performed using KOD Hot Start DNA polymerase (Merck Millipore). All restriction enzymes ...
-
bioRxiv - Biophysics 2019Quote: ... coli MG1655 genome by PCR into pET15b (Merck Millipore, Billerica, MA, USA) by Gibson assembly (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR reactions were performed using the KOD Hotstart DNA polymerase (Merck Millipore). Plasmid isolation ...