Labshake search
Citations for Merck :
1 - 50 of 154 citations for PCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... or Power SYBR Green PCR Master Mix (Merck). For all groups ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time quantitative PCR was performed using 5uL of KAPA Sybr Fast Universal 2x PCR master mix (Merck, #KK4601), 0.6uL of 5 uM forward primer ...
-
bioRxiv - Microbiology 2020Quote: ... Novagen Bugbuster Master Mix (Novagen, Merck, USA) and three additives (NaOH ...
-
bioRxiv - Microbiology 2023Quote: ... and FastStart Universal Sybr Green Master mix (Merck) in CFX Opus real-time system (BioRad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real time quantitative PCR was performed with KAPA SYBR FAST qPCR Master Mix (Sigma-Aldrich - Merck, UK, cat no KK4602) according to manufacturer’s instructions in a StepOnePlus Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μL of each sample were mixed with 7.5 μL of KAPA probe fast universal real-time PCR master mix (Merck, Darmstadt, Germany) and 2.5 μL of the indicated primer/probe combinations ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.5 mM TCEP) and half Master Mix Bug Buster (Merck) supplemented with a tablet of EDTA-free antiprotease cocktail (Roche ...
-
bioRxiv - Microbiology 2019Quote: ... the cells were harvested and digested with Bugbuster Master Mix (Merck Millipore). The mixture was then centrifuged at 15,000 g at 4 °C and the supernatant was filtered with a 0.22 μm filter (Merck Millipore) ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR was performed using REDTaq® ReadyMix™ PCR Reaction Mix (R2523, Merck-SIGMA) using previously published primers (Charalambous et al ...
-
bioRxiv - Zoology 2022Quote: ... 6 μL 2X Kappa2G Fast PCR Ready Mix (Merck, Germany). Primer concentrations and volumes differed between the multiplex assays and are detailed in Table S1 ...
-
bioRxiv - Bioengineering 2019Quote: ... the pellet was resuspended in 5 mL of the BugBuster Master Mix (Merck Millipore #71456) per gram of wet cell weight with EDTA-free protease inhibitor cocktail (Sigma #11836170001) ...
-
bioRxiv - Genomics 2021Quote: ... we added 15μL PCR mix containing 12.5μL KAPA HiFi HS mastermix (Merck), 0.25μL 10μM Smart-seq2 ISPCR primer (SigmaAldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... The primers were mixed with 10ng of extracted DNA and KAPA SYBR® FAST master mix (Merck KGaA, Damstadt, Germany). The qPCR reaction was performed (BIORAD CFX96 ...
-
bioRxiv - Microbiology 2021Quote: ... the cell suspensions were spun at 10,000 x g for 10 minutes and bacterial pellets were lysed by addition of BugBuster Master Mix (Merck Millipore) for 25 minutes at room temperature with gentle agitation ...
-
bioRxiv - Microbiology 2021Quote: ... spun at 10,000 x g for 10 minutes and bacterial pellets lysed by addition of BugBuster Master Mix (Merck Millipore) for 25 minutes at room temperature with gentle agitation ...
-
bioRxiv - Microbiology 2020Quote: ... and the pellet of 1 mL lysed with Bug Buster (pellet sample) (Bug Buster® Master Mix, Novagen® Merck). For lysis ...
-
bioRxiv - Microbiology 2023Quote: ... The cell suspensions were centrifuged at 10,000 x g for 10 minutes and bacterial pellets were lysed by addition of BugBuster Master Mix (Merck Millipore) for 25 minutes at room temperature with gentle agitation ...
-
bioRxiv - Molecular Biology 2023Quote: ... 22 µL sample was mixed with 25 µL 2x KAPA 2G robust HS Master Mix (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany), 1.5 µL 10 µM Index 1 primer and 1.5 µL 10 µM Index 2 primer ...
-
bioRxiv - Plant Biology 2022Quote: ... We mixed 0.1 μl template cDNA and 500 nM of each primer (Supplementary Table S1) with KAPA SYBR Fast qPCR Master Mix (Merck, Darmstadt, Germany). Each reaction comprised an initial denaturation step for 3 min at 95 °C ...
-
bioRxiv - Genomics 2023Quote: ... Splash mix (Merck) was added to the extraction solvent and tissue samples were lysed by beat beating in a FastPrep-24 homogenizer ...
-
bioRxiv - Molecular Biology 2019Quote: ... Amplified DNAs were purified with a Wizard SV Gel and PCR Clean-Up System and were used for in vitro transcription with Fluorescein RNA labeling Mix (Merck, #11685619910) and T7 (Merck ...
-
bioRxiv - Biochemistry 2023Quote: ... This mix was then deposited in sterilized 5 mm diameter plastic rings cut from PCR tubes (#683201, Greiner bio-one, Merck KGaA) on the surface of a chicken embryo chorioallantoic membrane ...
-
bioRxiv - Biochemistry 2020Quote: ... The calibration mix (Protein Standard Mix 15 – 600 kDa, Merck Millipore) was composed of the following proteins ...
-
bioRxiv - Molecular Biology 2022Quote: ... and hexanucleotide mix (Merck) as primer ...
-
bioRxiv - Plant Biology 2019Quote: ... Protease inhibitor mix (Merck), and 50 μM MG-132 (Cayman Chemical) ...
-
bioRxiv - Molecular Biology 2019Quote: ... mix with the primers (Merck) listed in Supplementary table 5 ...
-
bioRxiv - Neuroscience 2023Quote: ... FastStart Universal SYBR Green Master (Rox) (Merck) was used for quantitative PCR (qPCR) ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers for reverse-transcription PCR (RT-PCR) and quantitative RT-PCR (qRT-PCR) were supplied by Merck with standard desalting at 100 µM in TE buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... 1% of nucleoside mix (Merck Millipore), 1000 U/mL recombinant leukemia inhibitory factor (LIF/ESGRO ...
-
bioRxiv - Genomics 2020Quote: ... 1% of nucleoside mix (Merck Millipore), 1000 U/ml recombinant leukemia inhibitory factor (LIF/ESGRO ...
-
bioRxiv - Genomics 2022Quote: ... 1% of nucleoside mix (Merck Millipore), 1000 U/ml recombinant leukemia inhibitory factor (LIF/ESGRO ...
-
bioRxiv - Cancer Biology 2024Quote: ... All qPCR reactions used FastStart Universal Probe Master (Merck) with the manufacturer’s recommended reaction conditions with some minor adjustments ...
-
bioRxiv - Neuroscience 2023Quote: ... containing 12.5μL Reaction Mix (P4600, Merck, 12.5uL), 2 μL 20 μM Primers 8.5 μL molecular grade and 2μL Quick Extract gDNA sample ...
-
bioRxiv - Physiology 2020Quote: ... USA) with Fast Universal SYBR Green Master Rox (Roche, Merck). The primer sequences are listed in S2 Table ...
-
bioRxiv - Biophysics 2024Quote: ... reagents for energy mix were purchased from Merck. For the CDLA treatment ...
-
bioRxiv - Developmental Biology 2023Quote: ... Injection mix contained Fast Green dye (Merck F7258) for visual contrast ...
-
bioRxiv - Developmental Biology 2023Quote: ... Injection mix contained Fast Green dye (Merck F7258) for visual contrast ...
-
bioRxiv - Biochemistry 2024Quote: ... and Supelco 37-component FAME Mix (Merck, Germany) were used to identify and quantify each fatty acid ...
-
bioRxiv - Microbiology 2020Quote: ... contained 1x FastStart Universal SYBR Green Master (Rox) (Merck, Wicklow, Ireland), 0.6 µM primer pair ...
-
bioRxiv - Biochemistry 2020Quote: ... mix and 1 μL benzonase (250 units/μL, Merck) for 30 min on ice ...
-
bioRxiv - Molecular Biology 2020Quote: ... Chemical reagents and dNTP Mix were purchased from Merck.
-
bioRxiv - Immunology 2021Quote: ... The plasmid mix was prepared in DMEM (Merck, #D6429) containing X-treme Gene HP DNA Transfection Reagent (Merck ...
-
bioRxiv - Biochemistry 2023Quote: ... was used to plot elution profiles of the protein standard mix Supelco® 69385 Protein Standard Mix 15-600 kDa (Sigma-Aldrich/Merck, Darmstadt, Germany), and the analyzed protein samples.
-
bioRxiv - Biochemistry 2019Quote: ... using the Gateway™ BP Clonase™ II Enzyme mix (Merck). Constructs were assembled with the Gateway™ LR Clonase™ enzyme mix (Merck ...
-
bioRxiv - Immunology 2021Quote: ... The PCR product was gel purified (Illustra™ GFX PCR DNA and Gel Band Purification Kit, Merck) and used as template for in vitro transcription using the MEGAscript T7 Transcription Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... The fluorescent vital dyes mix used contain Hoechst 33342 (Merck-Sigma, USA) 1:10000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Thirty μl of PureProteome™ Protein A/G Mix Magnetic Beads (Merck) was washed in TBST and then incubated with 5 μl anti-HA antibody for 60 min at room temperature ...
-
bioRxiv - Immunology 2019Quote: ... PCR was performed using KOD polymerase (Merck). Samples were pooled across sub-amplicons and prepared for sequencing using NebNext Ultra II (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD polymerase (Merck) and the following primers (GTCTTGGTCATAGACACTGGTAG and GGCTGTTTAATAGGGGCTGAAC ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD polymerase (Merck) and the following primers (CAACTTACTCCTACTTGGCGT and XXXXTGCGTTGATACCACTGCTTT ...