Labshake search
Citations for Merck :
1 - 50 of 749 citations for PCR Buffers since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Primers for reverse-transcription PCR (RT-PCR) and quantitative RT-PCR (qRT-PCR) were supplied by Merck with standard desalting at 100 µM in TE buffer ...
-
bioRxiv - Immunology 2023Quote: ... and buffer exchanged to phosphate buffer saline by ultrafiltration (Merck Millipore). Integrity and purity of purified proteins were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis and Coomassie G-250 staining (ThermoFisher Scientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... RIPA buffer (R0278, Merck); HRP-conjugated anti-rabbit and HRP-conjugated anti-mouse (RABHRP1 and RABHRP2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR was performed using REDTaq® ReadyMix™ PCR Reaction Mix (R2523, Merck-SIGMA) using previously published primers (Charalambous et al ...
-
bioRxiv - Cancer Biology 2020Quote: ... and buffers were from Merck and SRL (Mumbai ...
-
bioRxiv - Developmental Biology 2022Quote: ... Antigen retrieval in citrate buffer (Merck) was followed by permeabilization with Triton X-100 (Merck ...
-
bioRxiv - Bioengineering 2019Quote: ... in 0.1 M cacodylate buffer (Merck) at pH 7.4 for 1h at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... in 0.2 M EPPS-buffer (Merck), pH 8.5 ...
-
bioRxiv - Plant Biology 2023Quote: ... in 0.2 M EPPS-buffer (Merck), pH 8.5 and reduced ...
-
bioRxiv - Plant Biology 2024Quote: ... in 0.2 M EPPS-buffer (Merck), pH 8.5 and vortexed under heating ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 10% EZ Lysis Buffer (Sigma/Merck), 0.5 U/μl RNase Inhibitor ...
-
bioRxiv - Immunology 2024Quote: ... were washed in Tyrode buffer (Merck) and placed on top of pericytes for ∼15 minutes at 37° C ...
-
bioRxiv - Molecular Biology 2024Quote: ... in 0.2 M EPPS-buffer (Merck), pH 8.5 and vortexed under heating ...
-
bioRxiv - Immunology 2021Quote: ... The PCR product was gel purified (Illustra™ GFX PCR DNA and Gel Band Purification Kit, Merck) and used as template for in vitro transcription using the MEGAscript T7 Transcription Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 600,000 cells were lysed using lysis buffer containing 50% of TruPAGE™ LDS Sample Buffer (PCG3009, Merck) and 20% 2-mercaptoethanol ...
-
bioRxiv - Biochemistry 2023Quote: ... the reaction buffer was exchanged to the lysis buffer five times by Amicon Ultra 10K (Merck Millipore). Then ...
-
bioRxiv - Immunology 2019Quote: ... PCR was performed using KOD polymerase (Merck). Samples were pooled across sub-amplicons and prepared for sequencing using NebNext Ultra II (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD polymerase (Merck) and the following primers (GTCTTGGTCATAGACACTGGTAG and GGCTGTTTAATAGGGGCTGAAC ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD polymerase (Merck) and the following primers (CAACTTACTCCTACTTGGCGT and XXXXTGCGTTGATACCACTGCTTT ...
-
bioRxiv - Cell Biology 2021Quote: Cells were lysed in RIPA buffer (Merck) supplemented with phosphatase and protease inhibitors ...
-
bioRxiv - Neuroscience 2020Quote: ... diluted in 0.16 M phosphate buffer (Merck KGaA ...
-
bioRxiv - Cancer Biology 2022Quote: ... salts and buffers were purchased from Merck or SRL (Mumbai ...
-
bioRxiv - Cell Biology 2020Quote: RIPA buffer (R0278, Merck/Sigma-Aldrich, UK) or NE-PER ™ Nuclear and Cytoplasmic Extraction Kit (78833 ...
-
bioRxiv - Physiology 2019Quote: ... in 0.1 M Na-cacodylate-buffer (Merck), pH of 7.33 ...
-
bioRxiv - Immunology 2020Quote: ... Elution buffer: 1.15 g/L Na2HPO4 (Merck), 0.20 g/L NaH2PO4 × H2O (Merck) ...
-
bioRxiv - Biochemistry 2021Quote: ... in RIPA buffer (150 mM NaCl (Merck), 5 mM EDTA (Merck) ...
-
bioRxiv - Cancer Biology 2022Quote: ... incubated with Red Blood Lysis buffer (Merck) and transferred through a 40 μm cell strainer ...
-
bioRxiv - Cancer Biology 2023Quote: ... and red blood cell lysis buffer (Merck) was subsequently added to the pellet ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and TAE Buffer were purchased from Merck/Sigma ...
-
bioRxiv - Biophysics 2022Quote: ... All buffer components were purchased from Merck KGaA ...
-
bioRxiv - Bioengineering 2023Quote: ... TRIS-EDTA (TE) buffer solution (Merck, UK); Embedding capsule (TAAB Laboratories equipment) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time quantitative PCR was performed using 5uL of KAPA Sybr Fast Universal 2x PCR master mix (Merck, #KK4601), 0.6uL of 5 uM forward primer ...
-
bioRxiv - Biochemistry 2019Quote: ... concentrated and buffer exchanged (kinase NMR buffer, see below) by ultrafiltration (Amicon Ultra-0.5 ml, 3 kDa MWCO, Merck) for NMR analysis.
-
bioRxiv - Biochemistry 2021Quote: HCT116 cells were lysed in RIPA buffer (for Mbd3) or Lysis Buffer (PBS with 0.1% NP-40) (for Tcf4) with protease inhibitor cocktail (Merck), 1 mM Na3VO4 ...
-
bioRxiv - Microbiology 2023Quote: ... The sample was buffer exchanged into TNE buffer by serial dilution and concentration using Amicon Ultra centrifugal filters (Merck).
-
bioRxiv - Biochemistry 2023Quote: ... Cells were washed twice in 40 µL/well flow buffer and resuspended in 40 µL/well flow buffer with 2.5 µg/mL DAPI (Merck). The median fluorescence intensity of living single cells was determined in triplicates using a ZE5 Cell Analyzer (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: 1×106 wt and hem1-/- DCs were spun down and lysed in 50µl 1x lysis buffer (1ml 10x RIPA buffer - NEB, 9ml H2O, 1 tablet PhosStop and 1 tablet protease inhibitor mini - both Merck). Lysates were spun at full speed for 10min at 4°C and supernatants transferred to new tubes ...
-
bioRxiv - Molecular Biology 2019Quote: ... The proteins were again diluted in 9 volumes of Exchange Buffer 2 (Exchange Buffer 1 with 200 mM NaCl) and concentrated with 30 MWCO Amicon Ultra-15 (Merck).
-
bioRxiv - Microbiology 2019Quote: ... and the pellet was resuspended in 0.1 M sodium acetate buffer (pH. 6) and dialysed against four changes of buffer using Amicon ultra centrifugal filters (Merck, Millipore ...
-
bioRxiv - Microbiology 2023Quote: ... were pre-prepared by washing 3 times in immunoprecipitation buffer then resuspended in 200μl immunoprecipitation buffer and coated with 2 μl FLAG M2 (Merck Millipore) or IgG (Merck Millipore ...
-
bioRxiv - Biophysics 2023Quote: ... in Tyrode buffer lacking Ca2+ (to reduce drastically both exo-and endocytosis; the Tyrode buffer contained 124 mM NaCl (#K52190904041, Merck), 5 mM KCl ...
-
bioRxiv - Cancer Biology 2024Quote: ... The supernatant was removed by placing samples on a magnetic stand, the beads were resuspended in 100 μL of Antibody buffer (Wash buffer, 0.025% Digitonin (Merck, 300410), EDTA 2 mM ...
-
bioRxiv - Microbiology 2021Quote: ... PCR grade water (Lichrosolv®; Merck, Darmstadt, Germany). The qPCR was performed in triplicates using the CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Genomics 2022Quote: ... contained in the Kap2G Robust PCR kit (MERCK) per sample and 9 μl added to each well need to be used in a 96-well plate ...
-
bioRxiv - Cell Biology 2023Quote: ... or Power SYBR Green PCR Master Mix (Merck). For all groups ...
-
bioRxiv - Genomics 2023Quote: ... PCR reactions were conducted using KAPA Taq (Merck) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... and post-fixed in 17 % sucrose buffer (Merck) containing 1 % OsO4 (Roth ...
-
bioRxiv - Molecular Biology 2020Quote: ... dropwise to HBS buffer (Sigma-Aldrich; Merck KGaA). This transfection complex was added dropwise to 7080% confluent cells then the cells were incubated at 37°C for 8 hours ...
-
bioRxiv - Microbiology 2020Quote: ... Loading buffer was 0.1% trifluoroacetic acid (Merck Millipore) in water ...
-
bioRxiv - Physiology 2019Quote: ... in 0.1M Na-cacodylate-buffer (Merck, Darmstadt, Germany) with a pH of 7.33 ...