Labshake search
Citations for Merck :
1 - 50 of 705 citations for Mouse RTF1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... MISSION® shRNA lentiviral plasmids (Merck) were used for knockdown of LOX (shLOX1 – TRCN0000045991 ...
-
bioRxiv - Pathology 2024Quote: ... Pcmt1 shRNA in PLKO plasmid (GCGCTAGAACTTCTATTTGAT, TRCN0000036400, Sigma-Merck USA) was transfected into HUVECs ...
-
bioRxiv - Physiology 2020Quote: ... MISSION shRNA (TRCN0000280118) or control pLKO plasmid were purchased from Merck and co-transfected with psPAX2 (a gift from Didier Trono ...
-
bioRxiv - Molecular Biology 2023Quote: The shRNA sequence in pLKO.3-GFP lentiviral vector against mouse KIS was GAGTGCGGAGAATGAGTGTTT (MISSION shRNA library, TRCN0000027622) and control non-mammalian shRNA was from Merck-Sigma (SHC002) ...
-
α-catenin links integrin adhesions to F-actin to regulate ECM mechanosensing and rigidity-dependencebioRxiv - Cell Biology 2021Quote: Lentiviral KD of α-catenin was performed using the SHCLNG-NM_009818 MISSION® shRNA plasmid (Merck); control cells were generated using the SHC202 -MISSION® TRC2 pLKO.5-puro Non-Mammalian shRNA Control Plasmid (Merck) ...
-
ST6GAL1-mediated heterogeneity in sialic acid levels potentiates invasion of breast cancer epitheliabioRxiv - Cancer Biology 2020Quote: ST6GAL1 gene shRNA clone was obtained from MISSION shRNA library (Sigma Merck, USA). Plasmid containing shRNA or scrambled control was packaged into lenti virus using packaging vectors pMD2.G and psPAX2 (packaging vectors were a kind gift from Dr ...
-
α-catenin links integrin adhesions to F-actin to regulate ECM mechanosensing and rigidity-dependencebioRxiv - Cell Biology 2021Quote: ... control cells were generated using the SHC202 -MISSION® TRC2 pLKO.5-puro Non-Mammalian shRNA Control Plasmid (Merck). After infection ...
-
bioRxiv - Neuroscience 2024Quote: ... For the expression of short hairpin RNA (shRNA) we used lentiviral plasmids pLKO.1-ATF4 for ATF4 (TRCN0000301721) with the target sequence: CGGACAAAGATACCTTCGAGT (#SHCLND, Merck) and for non-targeting controls a pLKO.1-plasmid encoding a scrambled sequence (shNTC) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1-shGAL-9 (MISSION® shRNA library, Merck), psPAX2 and pMD2.G (packaging vectors were a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... For RNA interference lentiviral particles were produced using following short hairpin RNA (shRNA) constructs purchased from the Mission TRC shRNA Library (Merck, Darmstadt, Germany): control shRNA (SHC002) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Expression of shRNA was induced with 0.1μg/ml doxycycline (Merck). Cells were counted every other day and the cell concentration was adjusted to 0.4×106/ml.
-
bioRxiv - Cancer Biology 2024Quote: ... we used the MISSION® Lentiviral shRNA (Sigma Aldrich/Merck, SHCLNG – clones ...
-
bioRxiv - Microbiology 2023Quote: ... PLKO.1 TRC cloning vectors expressing shRNA sequences were purchased from Merck or Dharmacon ...
-
bioRxiv - Immunology 2023Quote: ... Cells infected in two independent attempts with non-mammalian shRNA transduction particles (Merck) served as controls ...
-
bioRxiv - Developmental Biology 2021Quote: ... TBTX inducible knockdown in the TBXT shRNA sOPTiKD hESC line was achieved using tetracycline hydrochloride (Merck Life Science) at 1μg/ml as described previously (Bertero et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... TBTX inducible knockdown in the TBXT shRNA sOPTiKD hESC line was achieved using Tetracycline (Tet) hydrochloride (Merck Life Science) at 1 μg/ml as described previously (Bertero et al. ...
-
bioRxiv - Immunology 2023Quote: Cells were infected separately with five different lentiviral transduction particles (at MOI = 5) containing five different shRNA species (Merck) specific for the mouse Flot2 gene (NM_008028 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10,000 cells were seeded in 12-well dishes and co-infected the next day with 4EBP1 and 4EBP2 shRNA viruses in medium supplemented with 4 µg/ml polybrene (Merck). Cells were grown until confluency and reseeded into 6-well dishes prior to addition of 1 µg/ml puromycin (InvivoGen ...
-
bioRxiv - Immunology 2021Quote: Lentiviral plasmids encoding shRNAs targeting GFP (control; SHC005) and MAVS (06: TRCN0000149206; 45: TRCN0000148945) were obtained from the Sigma Mission library (Merck Darmstadt). Lentiviral particles for transduction were generated as follows ...
-
bioRxiv - Genomics 2021Quote: ... The cloned shRNAs against the respective EWRS1-ETS fusion oncogenes was induced by addition of 1 µg/ml dox (Merck, Darmstadt, Germany) to the cell culture medium ...
-
bioRxiv - Biochemistry 2022Quote: ... mouse anti-mouse FAP (Merck, MABC1145), mouse anti-CAR (Millipore ...
-
bioRxiv - Cell Biology 2022Quote: ... shMYO10 #3 and shMYO10 #4 cell lines were generated using lentiviruses particles containing a non-target control shRNA (Merck, Cat Number: SHC016V-1EA) or shRNA targeting human MYO10 respectively (shMYO10 #3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... PDGCLs were lentivirally transduced with the MISSION® shRNA vector pLKO.1-puro-CMV-Turbo green fluorescent protein (TurboGFP)_shnon-target (#SHC016, Sigma, part of Merck, Darmstadt, Germany) for cytosolic TurboGFP expression ...
-
bioRxiv - Physiology 2021Quote: ... The shRNA-containing vector was co-transfected with the pE-ampho vector into HEK293T cells using GeneJuice transfection reagent (Merck Millipore, Burlington, MA, USA). Supernatants containing viral particles were collected 48 h after the transfection ...
-
bioRxiv - Molecular Biology 2021Quote: ... T7 blue plasmid (Novagen, Merck Millipore) and human genomic DNA (Roche Diagnostics ...
-
bioRxiv - Bioengineering 2022Quote: ... using the plasmid pIEX (Merck Millipore) with a MB7 signal sequence ...
-
bioRxiv - Immunology 2020Quote: ... rAAVDJ or rAAV6 genome plasmid and Donor plasmid at a 3:1:1 ratio in Polyethylenimine (PEI)(Merck). In total each plate was teransfected with 41,250ng of DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... after which they were extracted using either GenElute Plasmid Miniprep or Midiprep plasmid DNA purification kit (Merck, Germany).
-
bioRxiv - Molecular Biology 2022Quote: ... and GenElute™ Plasmid Miniprep Kit (Merck), respectively ...
-
bioRxiv - Biochemistry 2024Quote: ... co- transformed with a pRARE plasmid (Merck). Uniformly-labelled proteins were expressed in M9 minimal media (6 g/L Na2HPO4 ...
-
bioRxiv - Cell Biology 2019Quote: ... GAPDH (mouse; Merck), FLAG (mouse ...
-
bioRxiv - Cell Biology 2019Quote: ... FLAG (mouse; Merck), FLAG (rat ...
-
bioRxiv - Neuroscience 2022Quote: ... FoxP2 (mouse, Merck Millipore ...
-
bioRxiv - Neuroscience 2022Quote: ... whole plasmids (Entry plasmids containing cmk-1 coding DNA sequences) were amplified with the KOD Hot Start DNA Polymerase (Novagen, Merck). Primers were phosphorylated in 5’ and were designed to contain the desired point mutation(s ...
-
bioRxiv - Biochemistry 2023Quote: ... and transiently transfected with the plasmid DNA containing GFP-tagged protein of interest (See Table S7 for plasmid constructs) using GeneJuice transfection reagent (70967, Merck) according to manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2020Quote: ... Plasmids were transformed into E.coli BL21 (DE3) (Merck) and grown overnight in LB media ...
-
bioRxiv - Bioengineering 2020Quote: ... Plasmids were transformed into E.coli BL21 (DE3) (Merck), and grown overnight in LB media supplemented with 100 μg/ml ampicillin ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse anti-GAPDH (Merck), and rabbit anti-actin (Santa Cruz ...
-
bioRxiv - Immunology 2021Quote: ... The plasmid mix was prepared in DMEM (Merck, #D6429) containing X-treme Gene HP DNA Transfection Reagent (Merck ...
-
bioRxiv - Bioengineering 2022Quote: Bacterial host strains and plasmids were purchased from Merck Millipore (Billerica ...
-
bioRxiv - Microbiology 2023Quote: ... coli and introduced into the plasmid pET21a (+) (Merck, Germany) at NdeI/XhoI restriction sites to give pSX1ImSX1 and pSX2ImSX2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... or mouse IgG (NXA931, Merck) and 1mg/ml of heparin for at 4 ֯C for 16 hours with end-over-end rotation ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 (mouse monoclonal from Merck), GABA A Receptor γ (guinea pig polyclonal from SYSY) ...
-
bioRxiv - Neuroscience 2021Quote: ... or mouse serum (Merck, M5905) as a mock condition (W ...
-
bioRxiv - Systems Biology 2022Quote: ... mouse anti-GAPDH (CB1001, Merck), rabbit phospho-Rb Ser807/811 (8516 ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-NeuN (Merck, MAB377), mouse anti-parvalbumin (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal anti-Rac1 (Merck Millipore ...
-
bioRxiv - Cell Biology 2023Quote: ... BUBR1 (mouse mAb, Merck, MAB3612), CENP-A (mouse mAb ...
-
bioRxiv - Cell Biology 2023Quote: ... tubulin (mouse mAb; Merck, T6199), BUB1 (rabbit pAb ...
-
bioRxiv - Microbiology 2022Quote: ... mouse anti-puromycin (Merck, MABE343) (1:10.000) ...