Labshake search
Citations for Merck :
1 - 50 of 269 citations for IFN alpha 2a Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Animals were randomly assigned to be treated with either 170,000 IU/kg human recombinant interferon alpha-2a (Merck), or BSA/saline (0.9% NaCl ...
-
bioRxiv - Microbiology 2021Quote: IFN-α and IFN-β or IL-6 and TNF-α were measured in supernatants of AMs or lung lysates using IFN alpha/IFN beta 2-Plex Mouse ProcartaPlex™ immunoassay (ebiosciences) or Milliplex MAP Mouse™ assay (Merck), respectively ...
-
bioRxiv - Genetics 2020Quote: ... then rhCG (recombinant human chorionic gonadotropin alpha, OVIDREL, Merck Serono) on day 9 Oocytes were collected by laparoscopic follicular aspiration 32–35 h after rhCG administration ...
-
bioRxiv - Developmental Biology 2023Quote: ... then 1,000 IU recombinant human chorionic gonadotropin alpha (rhCG, OVIDREL, Merck Serono) was injected on day 9 ...
-
bioRxiv - Molecular Biology 2023Quote: ... stained with anti-human IFN-γ and anti-human IL2 antibodies for 40 min at RT in 0.2% saponin (Merck, Germany) in PBS (Gibco ...
-
bioRxiv - Genetics 2020Quote: ... which was performed by intramuscular injection with rhFSH (recombinant human follitropin alpha, GONAL-F, Merck Serono) for 8 days ...
-
bioRxiv - Physiology 2023Quote: ... TNF-alpha (Merck); mouse monoclonal anti-CaSR (ab19347 ...
-
bioRxiv - Cancer Biology 2021Quote: ... # HS0000050421 and control lentiviral particles (U6-gRNA/EF1a-puro-2A-Cas9-2A-GFP) were purchased from Merck/Sigma ...
-
bioRxiv - Neuroscience 2019Quote: ... the rats were treated with either 170,000 IU/kg IntronA (human recombinant interferon-alpha 2b, Merck Sharp & Dohme Limited), or saline (0.9% NaCl ...
-
Integrated requirement of non-specific and sequence-specific DNA binding in MYC-driven transcriptionbioRxiv - Molecular Biology 2020Quote: ... ER-alpha (Merck, #06-935). Immunoprecipitated DNA was eluted in TE-2% SDS and crosslinks were reversed by overnight incubation at 65 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Alpha-Tubulin (Merck, T5168), HRP-conjugated secondary antibodies (Jackson ...
-
bioRxiv - Cell Biology 2023Quote: ... CT-2A (mouse glioma cells (SCC194, Merck)) ...
-
bioRxiv - Developmental Biology 2023Quote: ... healthy female cynomolgus monkeys were subjected to follicular stimulation by intramuscular injection of 20 IU of recombinant human follitropin alpha (rhFSH, Gonal F, Merck Serono) for 8 days ...
-
bioRxiv - Immunology 2023Quote: ... BT monkey IgA (alpha-chain) (Merck), horseradish peroxidase (HRP)-human IgG (EY Laboratories ...
-
bioRxiv - Immunology 2024Quote: ... with 1.2 mM alpha-thioglycerol (Merck), 10% heat inactivated fetal calf serum (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... IFN-2α and IFN-Y using a commercial multiplex system (Bio-Plex® Multiplex Immunoassay System, HCYTOMAG 13K MERCK). Samples were processed following the producer indications ...
-
bioRxiv - Microbiology 2021Quote: ... IFN-α (INTRON A, Merck, Sharpe & Dohme Corp.) was added for 24 h before virus infection challenge ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal anti-alpha tubulin (T5168, Merck), rabbit polyclonal anti-cortactin (A302-608A-M ...
-
bioRxiv - Immunology 2023Quote: ... IFN-α (100 U/ml; Merck, Rahway, NJ, USA), BAFF (20 ng/ml ...
-
bioRxiv - Neuroscience 2019Quote: ... and rabbit anti-2A peptide (Merck Millipore ABS31, 1:2000). All corresponding secondary antibodies were from ThermoFisher/Life technologies or Jackson ImmunoResearch laboratories ...
-
bioRxiv - Immunology 2023Quote: ... BT monkey IgA(alpha-chain) antibody (Merck, FRG), HRP-human IgG antibody (EY Laboratories ...
-
bioRxiv - Immunology 2021Quote: ... When cells were treated with IFN-α prior to infection (pre-treated) this was done with 1000 IU/ml IFN-α2b (referred to as IFN-α from here on; IntronA, Merck Sharp & Dohme Ltd). IFN-α remained on cells for the duration of experiments ...
-
bioRxiv - Immunology 2020Quote: ... When cells were treated with IFN-α prior to infection (pre-treated) this was done with 1000 IU/ml IFN-α2b (referred to as IFN-α from here on; IntronA, Merck Sharp & Dohme Ltd.) 18 h prior to infection ...
-
bioRxiv - Genomics 2024Quote: ... Pifithrin-alpha (Merck Life Science UK Limited, P4359-5MG) were dissolved in DMSO to generate stock solutions of 10 mM ...
-
bioRxiv - Cell Biology 2022Quote: ... alpha-smooth muscle actin (αSMA, clone 1A4, Merck, 1:1000), Col IV (ab19808 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-alpha tubulin (Merck-SIGMA, clone B-5-1-2) was used as a loading control at 1:10000.
-
bioRxiv - Immunology 2021Quote: ... previously coated with anti-mouse IFN-γ (clone RMMG-1, Merck, USA) and blocked with 1% bovine serum albumin (BSA ...
-
bioRxiv - Microbiology 2020Quote: ... the cells were stimulated with IFN-β (1,000 U/ml, 8 h, Merck), IFN-a2 (500 U/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-alpha-smooth muscle actin (αSMA, clone 1A4, Merck, Cat Number: A2547), anti-Slug (clone C19G7 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and incubation with mouse anti-alpha-tubulin antibody [1:20.000 (T6074, Merck)] and proceeding with secondary antibody staining and detection as described above.
-
bioRxiv - Immunology 2021Quote: ... TILs were then stained with APC anti-mouse IFN-γ mAb clone XMG1.2 (MERCK) and PerCP-Cyanine5.5 anti-mouse TNF-α mAb clone MP6-XT22 (BioLegend) ...
-
bioRxiv - Developmental Biology 2021Quote: ... blocking and incubation with mouse anti-alpha-Tubulin antibody (1:20.000 [T6074, Merck]) and proceeding with secondary antibody staining and detection as described above ...
-
bioRxiv - Physiology 2023Quote: ... a specific inhibitor targeting the alpha subunit of the Gi/o protein (Merck); U73122 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and anti-alpha sarcomeric actin clone 5C5 (#2172, Sigma-Aldrich, Merck Darmstadt, Germany) (1:500 v/v dilution in 5% BSA in PBS tween 0.05%) ...
-
bioRxiv - Genetics 2020Quote: ... Cells were left untreated or treated with IFN-α2b (INTRON A, Merck, 100 IU/ml) or IFN-λ3 (R&D Systems ...
-
bioRxiv - Developmental Biology 2020Quote: ... final oocyte maturation was triggered with 250 µg of alpha-choriogonadotropin (Ovitrelle®, MERCK) or 0.3 mg of triptorelin (Decapeptyl® ...
-
bioRxiv - Neuroscience 2022Quote: Rabies injected brains were immunohistochemically stained using antibodies against the 2A linker protein (Merck/ Millipore, ABS31, 1:2000) found in tTA expressing cells ...
-
bioRxiv - Immunology 2019Quote: ... Cells were interferon stimulated by the addition of 100 IU/ml recombinant interferon-β (IFN-β; Merck, 407318) to the growth media for 24 h ...
-
bioRxiv - Physiology 2019Quote: ... human tubal fluid (HTF) medium and human serum albumin (HSA) (Merck Millipore Corporation ...
-
bioRxiv - Cell Biology 2019Quote: Hela cells were transiently transfected with pSpCas9(BB)-2A-GFP (PX458)(83) encoding sgRNAs targeting VPS41 using X-tremeGENE (Merck) according to the manufacturers recommendation ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were incubated for 1 h at RT with a mouse anti-2A primary antibody (cat. no. MABS2005, Merck) diluted 1:2000 in 1% (w/v ...
-
bioRxiv - Microbiology 2021Quote: ... Human HDL (Merck Millipore) was incubated with NS1 for 1 hour at 37°C prior to the DSC experiments ...
-
bioRxiv - Immunology 2021Quote: Native human insulin (Merck) was pre-diluted in water to 1 mg/mL ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Negative control lines ‘NC’ and ‘NC#2’ were generated with U6gRNA-pCMV-Cas9–2A-GFP containing the guide tatgtgcggcaaaccaagcg (CRISPR08; Sigma-Aldrich/Merck). For three days prior to transfection ...
-
bioRxiv - Microbiology 2023Quote: ... auris cells (CHRIST Alpha 1-2 LD plus lyophilizer, Osterode, Germany) using Tri Reagent (Merck Ltd. Budapest, Hungary). The quality of RNA was determined using the Eukaryotic Total RNA Nano kit (Agilent ...
-
bioRxiv - Cell Biology 2019Quote: Human fibronectin was from Merck Millipore ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5.06% fibrinogen (human plasma; Merck), 3U/mL thrombin (Stago BNL ...
-
bioRxiv - Microbiology 2022Quote: ... Plasma-purified human thrombin (Merck) was then added to reactions as required from a 1 IU / μL stock ...
-
bioRxiv - Microbiology 2023Quote: ... the supernatant was discarded and aliquots (20 μL) of the remaining solution (500 μL) were plated on solid Reasoner’s 2A (R2A; Sigma-Aldrich, Merck, Rahway, NJ, USA) to confirm the absence of bacterial growth seven days after incubation at 25°C.
-
bioRxiv - Developmental Biology 2020Quote: Women were stimulated with highly purified urinary hMG (Menopur®, Ferring, Spain) or follitropin alpha (Gonal®, Merck-Serono, Spain), with daily injections of 150-300 IU (Blazquez et al. ...