Labshake search
Citations for Merck :
1 - 50 of 1832 citations for Human integrin alpha 5 beta 3 His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... Primary his tag antibody (05-949, Merck), stored in a skim milk solution ...
-
bioRxiv - Biochemistry 2021Quote: ... The His6-tag fusion proteins were purified with a cOmplete™ His-tag purification resin (Roche, Merck). The fusion proteins were cleaved by incubation with thrombin protease (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2021Quote: ... Human pancreatic beta cells 1.4E7 were purchased from Merck and cultured in RPMI-1640 medium (ThermoFisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... then rhCG (recombinant human chorionic gonadotropin alpha, OVIDREL, Merck Serono) on day 9 Oocytes were collected by laparoscopic follicular aspiration 32–35 h after rhCG administration ...
-
bioRxiv - Immunology 2021Quote: ... Human pancreatic beta cell line 1.4E7 was purchased from Merck and cultured in RPMI-1640 medium (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2020Quote: ... and the membrane was incubated with primary antibody (anti-his tag, 1:1000, Merck Millipore ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cleared lysate was added to cOmplete His-Tag Purification Resin (Merck Millipore/Roche) and incubated at 4°C for 1.5 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... the anti-S tag antibody (Merck, Cat# 71549-3) was added directly to the medium of each well resulting in a final dilution of 1:500 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-alpha tubulin (Merck-SIGMA, clone B-5-1-2) was used as a loading control at 1:10000.
-
bioRxiv - Developmental Biology 2023Quote: ... then 1,000 IU recombinant human chorionic gonadotropin alpha (rhCG, OVIDREL, Merck Serono) was injected on day 9 ...
-
bioRxiv - Cancer Biology 2021Quote: ... α6-integrin (Merck, monoclonal, MAB1378), Laminin V (Merck ...
-
bioRxiv - Plant Biology 2022Quote: ... The filtered supernatant was loaded onto a column packed with cOmpleteTM His-tag purification resin (Merck). His6-proteins were eluted with 4x 2 bead volumes of elution buffer (20 mM Na HEPES ...
-
bioRxiv - Microbiology 2021Quote: IFN-α and IFN-β or IL-6 and TNF-α were measured in supernatants of AMs or lung lysates using IFN alpha/IFN beta 2-Plex Mouse ProcartaPlex™ immunoassay (ebiosciences) or Milliplex MAP Mouse™ assay (Merck), respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... Purified human integrin α5β1 and anti-α5 (MAB1956Z) and anti-α5β1 (MAB1999) antibodies were from Merck (Kenilworth, NJ, USA). Volociximab was from Novus Biologicals (Littleton ...
-
bioRxiv - Neuroscience 2023Quote: ... R&D, AF2408), Goat-Anti Human SOX17 (1:100, R&D, AF1924) or Mouse Anti-Human Beta-Tubulin (1:1000, Merck, T8660) primary Chicken Anti-Human MAP2 (1:2000 ...
-
bioRxiv - Genomics 2020Quote: ... was incubated with/without 0.4μg human 6X-His-CDK9/Cyclin T1 (Merck, 140685) and/or 0.4μg human GST-tagged PP2A-α (Sigma ...
-
bioRxiv - Bioengineering 2020Quote: ... and the membrane was incubated with primary antibody (anti-his tag, 1:1000, Merck Millipore, Merck KGaA, Darmstadt, Germany) diluted in 2 % skim milk for 1 hour ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cdk1 and Cdc25B cDNAs were subcloned in frame with the N-terminal His-tag into pRSETa (Novagen, Merck Biosciences). Cdc25B cDNA was also subcloned into pcDNA3 without (pCdc25B) ...
-
bioRxiv - Genetics 2020Quote: ... which was performed by intramuscular injection with rhFSH (recombinant human follitropin alpha, GONAL-F, Merck Serono) for 8 days ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 5 μg/ml human insulin (Merck), and 50 μM hydrocortisone (Cayman ...
-
bioRxiv - Bioengineering 2021Quote: Three sender area squares (3 × 3 mm) were put into a 24-well containing 300 μL of anti-His antibody (Merck, Germany, NOVG70796-3) (10 μg mL−1 in DPBS ...
-
bioRxiv - Physiology 2023Quote: ... TNF-alpha (Merck); mouse monoclonal anti-CaSR (ab19347 ...
-
bioRxiv - Microbiology 2021Quote: ... and the supernatant was incubated with His-binding resin (Merck 69670-5) for 10-30 min at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-β5 integrin (Merck Sigma Aldrich, clone MB1.2), anti-AKT phospho S473 (CST 4060 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and applied directly onto a column of 2 ml pre-equilibrated Ni-NTA beads (cOmplete His-Tag Purification Resin from Merck). After several washes with high salt (500 mM NaCl) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the supernatant was loaded on to a gravity flow-based Ni-NTA metal affinity column (2 ml beads, cOmplete His-Tag Purification Resin from Merck), equilibrated and washed with 10 column volumes of buffer A containing 5 mM imidazole ...
-
bioRxiv - Molecular Biology 2020Quote: ... WT—or its mutants fused with a His-tag on the amino-terminus—were expressed in Escherichia coli BL21 (DE3) using pET15b vector (Merck). A single colony was inoculated in 2 mL Luria-Bertani broth (LB ...
-
Autorepression of Yeast Hsp70 co-chaperones by intramolecular interactions involving their J-domainsbioRxiv - Biochemistry 2024Quote: ... the supernatant was loaded onto a gravity flow-based Ni-NTA metal affinity column (2 ml beads, complete His-Tag Purification Resin from Merck), equilibrated and washed with 10 column volumes of buffer A containing 5 mM imidazole ...
-
bioRxiv - Biochemistry 2023Quote: ... His-tagged Trx1 was purified on a Ni2+ sepharose resin following the manufactureŕs instructions (cOmplete™ His-Tag Purification Resin, Merck).
-
bioRxiv - Cell Biology 2019Quote: ... Total β1-integrin was detected by immunoblotting the membrane again with clone N29 anti-β1-integrin antibody (Merck, MAB2252, 1:1000) and appropriate secondary antibody and analysis on the Odyssey (LI-COR ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Microbiology 2021Quote: ... The binding of CoVHH1-FLAG to S1 subunits-His tag was detected by incubating for 1 hour at room temperature with mouse monoclonal ANTI-FLAG® M2-Peroxidase (Merck) diluted with PBST ...
-
bioRxiv - Immunology 2020Quote: ... The elimination of the N-terminal His tag was performed through the cleavage with biotinylated thrombin included in the Thrombin Cleavage Capture Kit (Merck, Millipore) following manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... The His-tag-free Mpro in the flow-through was concentrated by using Amicon Ultra 15 centrifugal filters (10 kD, Merck Millipore) at 2773 x g ...
-
bioRxiv - Immunology 2022Quote: ... Animals were randomly assigned to be treated with either 170,000 IU/kg human recombinant interferon alpha-2a (Merck), or BSA/saline (0.9% NaCl ...
-
bioRxiv - Immunology 2023Quote: ... Lysate was clarified by spinning cells for 10 min at 20,000 × g before loading supernatant onto cOmplete™ His-Tag purification resin (Merck; cat # 5893682001). Bound proteins were washed with 20 mM tris (pH 8.0) ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Neuroscience 2019Quote: ... the rats were treated with either 170,000 IU/kg IntronA (human recombinant interferon-alpha 2b, Merck Sharp & Dohme Limited), or saline (0.9% NaCl ...
-
bioRxiv - Biochemistry 2022Quote: ... and both His6 and GST tags were cleaved with 5-10 unit thrombin (Merck) per milligram of protein for 24 h at 4°C and subjected to the SEC using the superdex 200 10/30 GL column ...
-
Integrated requirement of non-specific and sequence-specific DNA binding in MYC-driven transcriptionbioRxiv - Molecular Biology 2020Quote: ... ER-alpha (Merck, #06-935). Immunoprecipitated DNA was eluted in TE-2% SDS and crosslinks were reversed by overnight incubation at 65 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Alpha-Tubulin (Merck, T5168), HRP-conjugated secondary antibodies (Jackson ...
-
bioRxiv - Developmental Biology 2022Quote: ... and beta-mercaptoethanol (Merck, M6250) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The primary α5β1 integrin antibody (10 μg/mL) (Merck Millipore MAB1999) was added for 30 minutes at 4°C ...
-
bioRxiv - Biophysics 2023Quote: ... or anti-integrin blocking β2 (CD18) antibody (Merck, cat. no. CBL158), and the corresponding IgG1 isotype (rndsystems ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.