Labshake search
Citations for Merck :
1 - 50 of 330 citations for Human C17orf112 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... MISSION® shRNA lentiviral plasmids (Merck) were used for knockdown of LOX (shLOX1 – TRCN0000045991 ...
-
bioRxiv - Pathology 2024Quote: ... Pcmt1 shRNA in PLKO plasmid (GCGCTAGAACTTCTATTTGAT, TRCN0000036400, Sigma-Merck USA) was transfected into HUVECs ...
-
bioRxiv - Physiology 2020Quote: ... MISSION shRNA (TRCN0000280118) or control pLKO plasmid were purchased from Merck and co-transfected with psPAX2 (a gift from Didier Trono ...
-
α-catenin links integrin adhesions to F-actin to regulate ECM mechanosensing and rigidity-dependencebioRxiv - Cell Biology 2021Quote: Lentiviral KD of α-catenin was performed using the SHCLNG-NM_009818 MISSION® shRNA plasmid (Merck); control cells were generated using the SHC202 -MISSION® TRC2 pLKO.5-puro Non-Mammalian shRNA Control Plasmid (Merck) ...
-
ST6GAL1-mediated heterogeneity in sialic acid levels potentiates invasion of breast cancer epitheliabioRxiv - Cancer Biology 2020Quote: ST6GAL1 gene shRNA clone was obtained from MISSION shRNA library (Sigma Merck, USA). Plasmid containing shRNA or scrambled control was packaged into lenti virus using packaging vectors pMD2.G and psPAX2 (packaging vectors were a kind gift from Dr ...
-
α-catenin links integrin adhesions to F-actin to regulate ECM mechanosensing and rigidity-dependencebioRxiv - Cell Biology 2021Quote: ... control cells were generated using the SHC202 -MISSION® TRC2 pLKO.5-puro Non-Mammalian shRNA Control Plasmid (Merck). After infection ...
-
bioRxiv - Neuroscience 2024Quote: ... For the expression of short hairpin RNA (shRNA) we used lentiviral plasmids pLKO.1-ATF4 for ATF4 (TRCN0000301721) with the target sequence: CGGACAAAGATACCTTCGAGT (#SHCLND, Merck) and for non-targeting controls a pLKO.1-plasmid encoding a scrambled sequence (shNTC) ...
-
bioRxiv - Molecular Biology 2023Quote: The shRNA sequence in pLKO.3-GFP lentiviral vector against mouse KIS was GAGTGCGGAGAATGAGTGTTT (MISSION shRNA library, TRCN0000027622) and control non-mammalian shRNA was from Merck-Sigma (SHC002) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1-shGAL-9 (MISSION® shRNA library, Merck), psPAX2 and pMD2.G (packaging vectors were a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... For RNA interference lentiviral particles were produced using following short hairpin RNA (shRNA) constructs purchased from the Mission TRC shRNA Library (Merck, Darmstadt, Germany): control shRNA (SHC002) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Expression of shRNA was induced with 0.1μg/ml doxycycline (Merck). Cells were counted every other day and the cell concentration was adjusted to 0.4×106/ml.
-
bioRxiv - Cancer Biology 2024Quote: ... we used the MISSION® Lentiviral shRNA (Sigma Aldrich/Merck, SHCLNG – clones ...
-
bioRxiv - Microbiology 2023Quote: ... PLKO.1 TRC cloning vectors expressing shRNA sequences were purchased from Merck or Dharmacon ...
-
bioRxiv - Immunology 2023Quote: ... Cells infected in two independent attempts with non-mammalian shRNA transduction particles (Merck) served as controls ...
-
bioRxiv - Biochemistry 2021Quote: ... These Wild Type or Mutant Type let-7a-5p plasmids were co□transfected into treated human chondrocytes cells along with NC mimics or KCNQ1OT1 mimic (Sigma□Aldrich; Merck KGaA) using Lipofectamine 6000 following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... TBTX inducible knockdown in the TBXT shRNA sOPTiKD hESC line was achieved using tetracycline hydrochloride (Merck Life Science) at 1μg/ml as described previously (Bertero et al. ...
-
bioRxiv - Physiology 2019Quote: ... human tubal fluid (HTF) medium and human serum albumin (HSA) (Merck Millipore Corporation ...
-
bioRxiv - Developmental Biology 2023Quote: ... TBTX inducible knockdown in the TBXT shRNA sOPTiKD hESC line was achieved using Tetracycline (Tet) hydrochloride (Merck Life Science) at 1 μg/ml as described previously (Bertero et al. ...
-
bioRxiv - Immunology 2023Quote: Cells were infected separately with five different lentiviral transduction particles (at MOI = 5) containing five different shRNA species (Merck) specific for the mouse Flot2 gene (NM_008028 ...
-
bioRxiv - Microbiology 2021Quote: ... Human HDL (Merck Millipore) was incubated with NS1 for 1 hour at 37°C prior to the DSC experiments ...
-
bioRxiv - Immunology 2021Quote: Native human insulin (Merck) was pre-diluted in water to 1 mg/mL ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10,000 cells were seeded in 12-well dishes and co-infected the next day with 4EBP1 and 4EBP2 shRNA viruses in medium supplemented with 4 µg/ml polybrene (Merck). Cells were grown until confluency and reseeded into 6-well dishes prior to addition of 1 µg/ml puromycin (InvivoGen ...
-
bioRxiv - Immunology 2021Quote: Lentiviral plasmids encoding shRNAs targeting GFP (control; SHC005) and MAVS (06: TRCN0000149206; 45: TRCN0000148945) were obtained from the Sigma Mission library (Merck Darmstadt). Lentiviral particles for transduction were generated as follows ...
-
bioRxiv - Cell Biology 2019Quote: Human fibronectin was from Merck Millipore ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5.06% fibrinogen (human plasma; Merck), 3U/mL thrombin (Stago BNL ...
-
bioRxiv - Microbiology 2022Quote: ... Plasma-purified human thrombin (Merck) was then added to reactions as required from a 1 IU / μL stock ...
-
bioRxiv - Genomics 2021Quote: ... The cloned shRNAs against the respective EWRS1-ETS fusion oncogenes was induced by addition of 1 µg/ml dox (Merck, Darmstadt, Germany) to the cell culture medium ...
-
bioRxiv - Immunology 2022Quote: ... Human heat-aggregated IgG immune complexes (ICs) were prepared by heating human IgG1 isotype control (Merck) for 20 min at 63°C.
-
bioRxiv - Cell Biology 2022Quote: ... shMYO10 #3 and shMYO10 #4 cell lines were generated using lentiviruses particles containing a non-target control shRNA (Merck, Cat Number: SHC016V-1EA) or shRNA targeting human MYO10 respectively (shMYO10 #3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... PDGCLs were lentivirally transduced with the MISSION® shRNA vector pLKO.1-puro-CMV-Turbo green fluorescent protein (TurboGFP)_shnon-target (#SHC016, Sigma, part of Merck, Darmstadt, Germany) for cytosolic TurboGFP expression ...
-
bioRxiv - Bioengineering 2019Quote: ... human fibronectin (Merck-Millipore, Watford, UK) was premixed with Laponite gels to a final concentration of 50 µg/mL ...
-
bioRxiv - Microbiology 2019Quote: ... Binding of human FH (Merck Millipore) was detected with Alexa-Fluor-488 labeled human FH ...
-
bioRxiv - Immunology 2022Quote: ... Purified C1q from human serum (Merck) was used as a control.
-
bioRxiv - Systems Biology 2020Quote: ... anti-human MLKL (Merck Millipore, MABC604), phospho anti-human RPB1 S2 (Millipore ...
-
α-catenin links integrin adhesions to F-actin to regulate ECM mechanosensing and rigidity-dependencebioRxiv - Cell Biology 2021Quote: ... Human plasma full-length fibronectin (Merck) was added to the dish at a final concentration of 10 μg/μl for a 1h incubation at 37°C ...
-
bioRxiv - Immunology 2023Quote: Human IFNβ (IF014, Merck, KGaA, Darmstadt), IFNα2a (11100-1 ...
-
bioRxiv - Immunology 2024Quote: ... Human MC lines HMC-1.1 (Merck) and HMC-1.2 (Merck ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 5 μg/ml human insulin (Merck), and 50 μM hydrocortisone (Cayman ...
-
bioRxiv - Physiology 2021Quote: ... The shRNA-containing vector was co-transfected with the pE-ampho vector into HEK293T cells using GeneJuice transfection reagent (Merck Millipore, Burlington, MA, USA). Supernatants containing viral particles were collected 48 h after the transfection ...
-
bioRxiv - Molecular Biology 2021Quote: ... T7 blue plasmid (Novagen, Merck Millipore) and human genomic DNA (Roche Diagnostics ...
-
bioRxiv - Bioengineering 2022Quote: ... using the plasmid pIEX (Merck Millipore) with a MB7 signal sequence ...
-
Incidence of an intracellular multiplication niche amongst Acinetobacter baumannii clinical isolatesbioRxiv - Microbiology 2021Quote: A549 (human epithelial lung cell line) and EA.hy926 (human endothelial somatic cell line) cells were bought from Merck company and ATCC ...
-
Oxidative and non-oxidative active turnover of genomic methylcytosine in distinct pluripotent statesbioRxiv - Cell Biology 2020Quote: ... 10 μg/ml human holo-Transferrin (Merck), 12.5 mg/ml AlbuMAX I (Life Technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... and human plasma full-length fibronectin (Merck) was added to the dish at a final concentration of 10 µg/µl for a 1h incubation at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... human recombinant insulin (100 µg/mL; Merck), recombinant human insulin-like growth factor 1 (hIGF1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Recombinant human TNFα (GF023) was from Merck. Purified anti-His tag mouse antibody was from BioLegend (USA) ...
-
bioRxiv - Cell Biology 2021Quote: ... and human plasma full-length fibronectin (Merck) was added to the dish at a final concentration of 10 μg/μl for a 1h incubation at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... mouse anti-human α5 IgG1 (JBS5; Merck), mouse anti-human α5 IgG3 (P1D6 ...
-
bioRxiv - Physiology 2022Quote: ... labelled human mitochondria primary antibody (Merck, MAB1273), 1:500 for 48 h at 4°C and washed with PBS overnight at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... rat anti-human β1 IgG1 (AIIB2; Merck), mouse anti-human β1 IgG1 (Lia1/2 ...