Labshake search
Citations for Merck :
1 - 50 of 4547 citations for Fipronil Sulfone 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... Prepared solutions were mixed at 3:1 ratio with 20% α-cyano-4-hydroxycinnamic acid (Merck) solution in 20% ACN ...
-
bioRxiv - Immunology 2022Quote: ... approximately 5×105 Calu-3 cells were pre-treated with kp7-6 (100 ug/mL, CD95/CD95L antagonist, Merck) for 2 hour and then infected with SARS-CoV-2 at an MOI of 0.2 ...
-
bioRxiv - Biochemistry 2023Quote: ... and α-cyano-4-hydroxycinnamic acid (α-CHCA) from Merck KGaA (Darmstadt ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
bioRxiv - Microbiology 2020Quote: ... methanol 98% (Merck), dimethyl sulfoxide (DMSO ...
-
bioRxiv - Genomics 2022Quote: ... in 3×250 ml bottles and resuspended in 100 ml prewarmed 30°C YPD supplemented with 50 ug/ml Pronase (Merck 10165921001), at which point the count-up for the time course was initiated ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Bioengineering 2021Quote: ... 99%+, Figure S1(d)), and dimethyloctadecyl[3-(trimethoxysilyl)propyl]ammonium chloride (DMOAP, 42% solution in methanol) were obtained from Merck–Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Neuroscience 2022Quote: ... was combined with 90μM sygRNA (5’ - GGATTTGGTAATAGCAG AGGGGG 3’) (Merck) at RT for 15 minutes to form an RNP complex ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA oligonucleotide G4A4 (5’-AAAAAAGGGGAAAAGGGGAAAAGGGGAAAAGGGGAAAAAA-3’) was purchased from Merck. CD analysis of 2,5 µM RNA was carried out in the buffer used for G4-pulldown ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3-OCT (1:167, Merck, Darmstadt, Germany, CAS #589-98-0) were diluted in mineral oil (Thermo Fisher ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 20 μl, 5 mg/ml, Merck) was added to each well ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... and n-butanol (nBuOH) (3 × 100 mL each, Merck, China). The extract of each phase was concentrated in vacuo ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV titer was quantified using PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Developmental Biology 2019Quote: ... The cells were passaged per 3–5 days using Accutase (Merck-Millipore), mechanically scraped ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 3 h or with 100 ng/ml nocodazole (M1404, Merck) for 6 h ...
-
bioRxiv - Neuroscience 2020Quote: ... pH 7.4) (final concentration: 12mg/mL) containing 5 μL Benzonase (final concentration: 1 μL benzonase/mL (MERCK, 71205-3). After dissolving ...
-
bioRxiv - Physiology 2023Quote: ... Samples were separated on a SeQuant ZIC-pHILIC column (100 3 2.1 mm, 5 mm, polymer, Merck-Millipore) including a ZIC-pHILIC guard column (2.1 mm x 20 mm ...
-
bioRxiv - Neuroscience 2023Quote: ... nystatin (3 units/ml) (Merck: N1638) and ascorbic acid (500 μM ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 units/ ml nystatin (Merck: N1638) and 20 mM HEPES ...
-
bioRxiv - Developmental Biology 2019Quote: ... The cells were blocked in 3% BSA (Applichem) and 5% donkey serum (Merck) in PBS for 2 hours at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... reverse: 5’-CCAGGGTGGAGCGGTC-3’) and the KOD Hot Start Mastermix (Merck, Darmstadt, Germany). The plasmids were confirmed by sequencing (Seqlab ...
-
bioRxiv - Biochemistry 2023Quote: ... PAPS (adenosine 3′-phosphate 5′-phosphosulfate, lithium salt hydrate) was purchased from Merck and stored at -80 °C to afford maximal stability.
-
bioRxiv - Microbiology 2020Quote: ... In the first tube, 6 ml of amniotic fluid was dissolved in 3 ml of glycerol (≥99 %, G2025, Sigma-Aldrich (Merck), Overijse ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were permeabilized with 0.1% Triton X-100 for 3 minutes and then blocked with 5 or 10% bovine serum albumin (BSA, Merck) in PBS for 20 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... Pure standards of (Z)-3-hexenyl acetate (Z3HAC, 98 %, CAS number 3681-71-8, Merck) was used in different concentrations ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Biochemistry 2023Quote: ... membrane using wet transfer for 3 h at 90 V/4 °C in transfer buffer (25 mM Tris; 192 mM glycine, Merck; 20% methanol, Merck). Afterwards ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Biochemistry 2019Quote: ... and csm5 were cloned into pACYCDuet-1 (5’-NcoI, 3’-XhoI; Novagen, Merck Millipore), csm4 was cloned into pEHisTEV (5’-NcoI ...
-
bioRxiv - Neuroscience 2022Quote: ... with a Chromolith® RP-18 endcapped 5-3 guard cartridges (Merck, Darmstadt, Germany), operated under a flow rate of 0.3 mL/min ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by 3 PBS washes and blocking with 5% bovine serum albumin (BSA; Merck) for 1 hour ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 50 µL benzaldehyde (BA) and 250 µL 3-octanol (OCT) (CAS 100-52-7, and 589-98-0, respectively; Merck, Darmstadt, Germany) were applied undiluted to 1-cm-deep Teflon containers of 5 and 14 mm diameter ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Microbiology 2023Quote: ... We used sterile-filtered 3 % bovine serum albumin (BSA heat shock fraction, pH 7, > 98 %, Merck) in 1 × Pierce PBS buffer (Thermo Fisher Scientific ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...