Labshake search
Citations for Merck :
1 - 50 of 2375 citations for Estrone 3 Sulfate E1S ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... 5-HT (Serotonin creatinine sulfate monohydrate, H7752, Merck), m-CPBG (1-(3-Chlorophenyl)biguanide hydrochloride ...
-
bioRxiv - Neuroscience 2020Quote: ... 5% aluminum sulfate solution (Merck Millipore, ref. 1.00121) for 5 min ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Nunc MaxiSorp ELISA plates (M9410, Merck), 10% BSA ELISA reagent diluent/blocking solution concentrate (DY995 ...
-
bioRxiv - Immunology 2022Quote: ... the blood was supplemented with prostaglandine E1 (Merck KGaA), Apyrase (New England Biolabs GmbH ...
-
bioRxiv - Cancer Biology 2023Quote: ... Vincristine sulfate (Merck) was dissolved and diluted in saline ...
-
bioRxiv - Cell Biology 2023Quote: ... cholesterol sulfate (Merck) at 35μM ...
-
bioRxiv - Microbiology 2023Quote: ... The filters were then transferred to 7H10 plus ADS plates containing Sodium sulfate-34S (Merck 718882) containing either 50uM CHP or no CHP for 24 and 48 h ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Physiology 2020Quote: ... according to the manufacturer’s instructions (Mouse Leptin ELISA Kit, 90030; Crystal Chem, Zaandam, Netherlands; Rat/Mouse Insulin ELISA Kit, cat. EZRMI-13K; Merck Millipore). The intra- and interassay coefficients of variation (CVs ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10% dextran sulfate (Merck), 1 μL RNase cocktail (ThermoFisher) ...
-
bioRxiv - Cell Biology 2021Quote: ELISA was performed to detect serum GH (rat/mouse growth hormone ELISA kit, Merck KGaA, Dermstadt, Germany), IGF-1 (mouse/rat IGF-1 ELISA kit ...
-
bioRxiv - Neuroscience 2021Quote: ... The concentrations of Aβ40 and Aβ42 were determined in brain lysates using the ELISA kits according to the manufacturer’s instructions (human Aβ40 and Aβ42 brain ELISA, Merck).
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... 21.6% dextran sulfate (Merck, D8906)] ...
-
bioRxiv - Cell Biology 2023Quote: ... 5g/l ammonium sulfate (Merck), 2% (w/v ...
-
CXCL17 binds efficaciously to glycosaminoglycans with the potential to modulate chemokine signallingbioRxiv - Immunology 2023Quote: ... chondroitin sulfate-A (CS) (Merck), were biotinylated as previously described in [46] ...
-
bioRxiv - Cell Biology 2023Quote: ... 10% dextran sulfate (Merck, S4030), 10 mM ribonucleoside-vanadyl complex (NEB ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Respective ELISA kits (insulin, leptin, IL-6 – MilliPlex Map Mouse Adipokine kit, Merck, Germany ...
-
bioRxiv - Microbiology 2021Quote: ... GLP-1 (GLP-1 total ELISA kit, Merck, Darmstadt, Germany) and biochemical parameters including ALT ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Cell Biology 2022Quote: ... and 2 mM copper sulfate (Merck) for 30 min at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... and high-sensitivity GLP1 Active ELISA kit were acquired from Merck Millipore (Billerica ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Developmental Biology 2019Quote: ... or 50 μg/ml protamine sulfate (Merck) according to the experiment ...
-
bioRxiv - Microbiology 2020Quote: ... 0.07% ammonium sulfate (NH4)2SO4 (Merck USA), 0.106% weight vol−1 Tris base (Omnipur ...
-
bioRxiv - Cell Biology 2020Quote: ... galactose-4-sulfate was purchased from Merck KGA (Germany).
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-NG2 Chondroitin Sulfate Proteoglycan (Merck), mouse anti-AXL (R&D systems) ...
-
CXCL17 binds efficaciously to glycosaminoglycans with the potential to modulate chemokine signallingbioRxiv - Immunology 2023Quote: ... heparan sulfate (HS) from bovine kidney (Merck), chondroitin sulfate-A (CS ...
-
bioRxiv - Microbiology 2021Quote: ... the serum levels of total GLP-1 (ELISA kit, Merck, Darmstadt, Germany) and IAA (ELISA kit ...
-
bioRxiv - Developmental Biology 2022Quote: ELISA kits were used for measurements Growth Hormone (Merck-SIGMA EZRMGH-45K) according to manufacturers’ instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... Plasma leptin and insulin levels were measured by murine ELISA kits (Merck Millipore ...
-
bioRxiv - Neuroscience 2023Quote: ... We measured Leptin levels using mouse leptin ELISA kit (Merck Life Sciences) according to manufacturer’s instructions.
-
bioRxiv - Microbiology 2019Quote: ... TLC plates (3 × 10 cm) (TLC Silica Gel 60 F254, Merck) were spotted by simply touching the end of a capillary tube containing fungal crude extract to the coated side of the TLC plates ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Neuroscience 2022Quote: ... was combined with 90μM sygRNA (5’ - GGATTTGGTAATAGCAG AGGGGG 3’) (Merck) at RT for 15 minutes to form an RNP complex ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA oligonucleotide G4A4 (5’-AAAAAAGGGGAAAAGGGGAAAAGGGGAAAAGGGGAAAAAA-3’) was purchased from Merck. CD analysis of 2,5 µM RNA was carried out in the buffer used for G4-pulldown ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Seed cultures from glycerol stocks were inoculated 20 hours overnight in 5 mL Invitrogen Luria Broth Base LB medium (ThermoFischer, USA) and supplemented with Kanamycin sulfate (Merck, Germany) (50 μg/mL) ...
-
bioRxiv - Bioengineering 2022Quote: ... Magnesium Sulfate Heptahydrate (MgSO4.7H2O) was purchased from Merck. Photoresist AZ1505 (AZ ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Polymyxin B sulfate (Merck Millipore, 10 μg/mL), thymidine (Alfa Aesar ...
-
bioRxiv - Systems Biology 2023Quote: ... and 10% (w/v) Dextran Sulfate (Merck, S4030) 23 on a Hybrislip at 37°C overnight in a humidified chamber ...
-
bioRxiv - Cell Biology 2024Quote: ... and 0.05% w/v dextran sulfate (Merck D4911) and Image-iT FX reagent (Invitrogen I36933 ...
-
bioRxiv - Biochemistry 2021Quote: ... and 5 μg of transfer plasmid per plate using polyethylenimine (Merck) as transfection reagent ...
-
bioRxiv - Systems Biology 2022Quote: ... 10+3) were seeded onto fibronectin coated plates (20 µg/mL, FC010 Merck) at a density of 0.25 x 106 cells/cm2 and cultured for three (d3 ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.1 % sodium dodecyl sulfate (SDS) (Merck, cat. no. L6026)) supplemented with 1x cOmplete™ Protease Inhibitor Cocktail (Merck) ...