Labshake search
Citations for Merck :
1 - 50 of 235 citations for DNA Polymerase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... KOD Hot Start DNA polymerase (Merck) was used for all PCR reactions according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... KOD Hot Start DNA polymerase (Merck) was used for all PCR reactions according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... using KOD DNA polymerase (Merck Millipore). All plasmids were verified by sequencing.
-
bioRxiv - Cell Biology 2020Quote: ... using either KOD DNA polymerase (Merck Millipore), Phusion DNA polymerase (NEB ...
-
bioRxiv - Cell Biology 2021Quote: KOD-Xtreme hot-start DNA polymerase (Merck Millipore), DreamTaq™ Green PCR Master Mix (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2020Quote: ... KOD Hot Start DNA polymerase (0.02U/μL; Merck) was used with the following programme ...
-
bioRxiv - Microbiology 2021Quote: ... using KOD Hot Start DNA polymerase (Merck Millipore) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... using the KOD Hot Start DNA polymerase (Merck). Amplification reactions performed with complementary oligonucleotides were then mixed ...
-
bioRxiv - Microbiology 2022Quote: ... or KOD HotStart DNA polymerase (Merck, Darmstadt, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... KOD-Xtreme hot-start DNA polymerase (Merck Millipore), DreamTaq™ Green PCR Master Mix (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: KOD-Xtreme hot-start DNA polymerase (Merck Millipore), DreamTaq™ Green PCR Master Mix (ThermoFisher Scientific) ...
-
bioRxiv - Biochemistry 2024Quote: ... or using KOD Hot-start DNA polymerase (Merck) followed by DpnI treatment ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD Hot Start DNA polymerase (Merck). PCR products were purified using the Monarch PCR and DNA Cleanup Kit (NEB ...
-
bioRxiv - Bioengineering 2020Quote: ... AGPAT1 was then amplified by PCR with KOD DNA polymerase (Merck) using primer pair 5’-CACCATGGATTTATGGCCTGGTGC-3’ & 5’-TCATCCTCCTCCACCTGG-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... circular DNA molecules were amplified with random examers and TempliPhi DNA polymerase (Merck KGaA, Darmstadt, Germany) following manufacturer’s instruction ...
-
bioRxiv - Plant Biology 2019Quote: ... the complete coding sequence was amplified with KOD DNA Polymerase from Merck Millipore (Schwalbach am Taunus ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCR amplification was performed by KOD Hot Start DNA polymerase (Merck Millipore). All enzymes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCR amplifications were performed using KOD Hot Start DNA polymerase (Merck Millipore). All restriction enzymes ...
-
bioRxiv - Cell Biology 2021Quote: ... WT SETDB1 was amplified by KOD Hot Start DNA Polymerase (71086, Merck) and the oligonucleotides 5’-cagagctcATGTCTTCCCTTCCTG GGTGCAT-3’ and 5’-gtgtcgaCTAAAGAAGACGTCCTCTGCATTCAAT-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... KOD Xtreme Hotstart DNA polymerase kit was obtained from Merck (Darmstadt, Germany). T4 DNA ligase was obtained from New England Biolabs (NEB) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR reactions were performed using the KOD Hotstart DNA polymerase (Merck Millipore). Plasmid isolation ...
-
bioRxiv - Cell Biology 2020Quote: ... Each of these three amplicons were amplified by Polymerase Chain Reaction (PCR) using the high-fidelity DNA polymerase KOD (Merck, Darmstadt, Germany). The primers used to amplify the three amplicons of the sixteen prototypes were designed with overlapping regions to perform overlapping PCR with primers which included attB1 and attB2 Gateway recombination sites at the forward and reverse primer ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR reaction was carried out using KOD Hot Start DNA polymerase (Merck) according to manufacturer’s instruction ...
-
bioRxiv - Synthetic Biology 2020Quote: ... All PCR reactions were carried out by KOD Hot Start DNA polymerase (Merck Millipore). PCR and Gel purification were done using Qiaquick nucleotide removal kit (qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... Other UL49.5 variants were generated by PCR using KOD Hot Start DNA polymerase (Merck), pLZRS-UL49.5-IRES-GFP(7 ...
-
bioRxiv - Neuroscience 2022Quote: ... whole plasmids (Entry plasmids containing cmk-1 coding DNA sequences) were amplified with the KOD Hot Start DNA Polymerase (Novagen, Merck). Primers were phosphorylated in 5’ and were designed to contain the desired point mutation(s ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The designed promoters were obtained by either PCR (KOD Hot-Start DNA polymerase, Merck-Millipore). PCR amplification was performed by KOD Hot Start DNA polymerase (Merck Millipore) ...
-
bioRxiv - Molecular Biology 2019Quote: Site directed mutagenesis was carried out using the KOD Xtreme™ Hot Start DNA Polymerase kit (Merck). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... ModQ-oE-F and ModQ-oE-R (Supplementary Table S3) with KOD Hot- start DNA polymerase (Merck) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: Putative promoter sequences were amplified from genomic DNA using the KOD Hot start polymerase (#71086-5, Merck Millipore) and cloned into pJET1.2 (#K1231 ...
-
bioRxiv - Microbiology 2022Quote: ... and SAM_Seq_Gen59708_RV (5’-ACA AGA GGC GGC TTT ATG TTC C) together with KOD Hot Start DNA Polymerase (Merck). Additionally ...
-
bioRxiv - Plant Biology 2019Quote: ... The amplification of ALBA genome sequences was carried out with high-fidelity KOD Hot Start DNA Polymerase (Merck Millipore), according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and SAM_Seq_Ex8_RV (5’-CTT CTT ATT GCC TCC TCT GGC ACA GC) together with KOD Hot Start DNA Polymerase (Merck) or KAPA HiFi HotStart ReadyMix ...
-
bioRxiv - Microbiology 2020Quote: ... using KOD polymerase (Merck-Millipore ...
-
bioRxiv - Biochemistry 2020Quote: ... The KOD polymerase (Merck) was used for all PCR amplifications ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We carried out polymerase chain reactions (PCRs) with Hot Start polymerase (MERCK MILLIPORE) and performed colony PCRs with Taq polymerase (NEB) ...
-
bioRxiv - Cell Biology 2021Quote: ... CDC50.3 and CDC50.4 were generated using a PCR fragment encoding the mAID–HA and the HXGPRT cassette produced using the KOD DNA polymerase (Novagen, Merck) with the vector pTUB1:YFP-mAID-3HA as template and the primers indicated in Table S2 ...
-
bioRxiv - Cell Biology 2024Quote: ... Truncated forms were generated by PCR of the entire plasmid except the region to be excluded using KOD HotStart DNA polymerase (Merck) and the forward primers pUL71 295 fwd ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... following the recommandations of Meck supplier when using the Roche Taq DNA polymerase (5U/µL; #11146165001; Merck KGaA, Darmstadt, Germany) and supplemented in DMSO ...
-
bioRxiv - Molecular Biology 2019Quote: ... or SP6 polymerase (Merck, #11487671001).
-
bioRxiv - Microbiology 2021Quote: ... and SsuT3-oE-R (5′-AGTCAG GGATCC CTA CAC CAC CTT CAC TTT GGT ACC) with KOD Hot Start DNA polymerase (Merck Millipore) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... primers 1022700 5F and R were used to amplify the 572 bp 5’ homology flank and primer pair 1022700 3F and R was used to amplify the 673 bp 3’ homology flank (KOD Hot Start DNA Polymerase, Merck Millipore) which were cloned on either side of the sfGFP expression cassette in pkiwi003 (Ashdown et al. ...
-
bioRxiv - Plant Biology 2019Quote: ... A 323 bp fragment was amplified from CAM leaf cDNA using high fidelity PCR with KOD Hot Start DNA Polymerase (Merck, Germany). The amplified fragment spanned the 3’ end of the PPC1 coding sequence and extended into the 3’ untranslated region to ensure specificity of the silencing to both of the aforementioned CAM-associated PPC1 gene copies ...
-
bioRxiv - Cell Biology 2020Quote: ... The region was amplified by polymerase chain reaction (PCR) with KOD Hot Start Polymerase (Merck) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... KOD Hot Start polymerase (Merck Millipore) was used amplify the mCherry-M2×24 sequence to incorporate a 5’ AgeI site and a 3’ BamHI site ...
-
bioRxiv - Immunology 2019Quote: ... PCR was performed using KOD polymerase (Merck). Samples were pooled across sub-amplicons and prepared for sequencing using NebNext Ultra II (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD polymerase (Merck) and the following primers (GTCTTGGTCATAGACACTGGTAG and GGCTGTTTAATAGGGGCTGAAC ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD polymerase (Merck) and the following primers (CAACTTACTCCTACTTGGCGT and XXXXTGCGTTGATACCACTGCTTT ...
-
bioRxiv - Cell Biology 2021Quote: ... using KOD polymerase site-directed mutagenesis (Merck Millipore). Xport-A4L insert was then amplified by PCR with primers listed above and Gibson assembly was used to create N-terminal and C-terminal HA tagged pUASTattb constructs.
-
bioRxiv - Synthetic Biology 2019Quote: ... and amplified using KOD high-fidelity polymerase (Merck). For promoters and sgRNA binding sites ...