Labshake search
Citations for Merck :
1 - 50 of 2400 citations for Calcium calmodulin Dependent 3' 5' Cyclic Nucleotide Phosphodiesterase 1C PDE1C Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ cyclic mono-phosphate (8-Br-cAMP, Merck B5386) and 1 μM medroxyprogesterone acetate (MPA ...
-
bioRxiv - Microbiology 2022Quote: ... 1ml of calmodulin resin (MERCK) pre-equilibrated in wash buffer containing 20 mM HEPES-Na pH 7.2 ...
-
bioRxiv - Physiology 2020Quote: ... and mouse anti-calmodulin (1:100, Merck, 05-173); or mouse anti-S-tag (for S-tagged NTD ...
-
bioRxiv - Neuroscience 2020Quote: Dibutyryl cyclic AMP (AMPc) (Merck Sigma, #D0627)
-
bioRxiv - Immunology 2023Quote: ... the mice were intranasally sensitized using 1 μg of 2′3′-cyclic GMP-AMP (cGAMP, 531889; Merck Darmstadt, Germany) and 1 μg of (HDM ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The interlocking ring included a central odorant delivery platform (Additional File 1C) comprising a 10-mm-diameter cover glass and two 5-mm-diameter filter discs (WHA10016508; Merck) for the evaluation of VOCs that interact with or blend with human odor (stl files are provided in additional files 2 and 3) ...
-
bioRxiv - Physiology 2023Quote: ... a phosphodiesterase-resistant cAMP analogue and PKA activator (Merck Life Science, Dorset, UK); Bordetella PTX ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1 M 8-Bromoadenosine 3’5’-cyclic monophosphate (cAMP; Merck, B5386), 0.1 M 3-Isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Cell Biology 2022Quote: ... Calcium free or calcium high solutions contained either 15 mM EGTA (Merck) or 25 mM CaCl2 ...
-
bioRxiv - Neuroscience 2024Quote: ... dibutyryl cyclic AMP (dbcAMP; cat# D0627) (all from Merck, Auckland, NZ), DAPT (cat# 2088055 ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: Cell-cycle kinetic differences were assessed by labelling cortical progenitor cells using a nucleotide analog 5-ethynyl-2’-deoxyuridine (EdU; Merck) in vivo following 150 □g EdU injection into the peritoneal cavity of pregnant mice 1 hour before the sacrifice of the embryos ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Developmental Biology 2021Quote: ... containing 2 mM calcium chloride (Merck, C27902) overnight at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... containing 2 mM calcium chloride (Merck, C27902) overnight at 4°C ...
-
bioRxiv - Plant Biology 2021Quote: ... 14-3-3 binding was detected using anti-GST monoclonal antibody (Merck).
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Bioengineering 2023Quote: ... Calcium chloride was obtained from Merck (Darmstadt, Germany). Medium viscosity sodium alginate ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Neuroscience 2022Quote: ... was combined with 90μM sygRNA (5’ - GGATTTGGTAATAGCAG AGGGGG 3’) (Merck) at RT for 15 minutes to form an RNP complex ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA oligonucleotide G4A4 (5’-AAAAAAGGGGAAAAGGGGAAAAGGGGAAAAGGGGAAAAAA-3’) was purchased from Merck. CD analysis of 2,5 µM RNA was carried out in the buffer used for G4-pulldown ...
-
bioRxiv - Developmental Biology 2023Quote: CYP450-dependent metabolization was determined by using the fluorometric probe BFC (Merck, B5057) as previously described32 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using 4 µM calcium ionophore A23187 (cat. C7522, Merck). The GSK484 concentrations were 1 µM ...
-
bioRxiv - Biophysics 2024Quote: ... we prepared 100 mg/mL BSM solutions using the previously described method and added the following substances: Six different concentrations of calcium chloride (as calcium chloride dihydrate, Merck KGaA, ≥99.0 %, C7902) 2.7 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the anti-S tag antibody (Merck, Cat# 71549-3) was added directly to the medium of each well resulting in a final dilution of 1:500 ...
-
bioRxiv - Developmental Biology 2019Quote: ... The cells were passaged per 3–5 days using Accutase (Merck-Millipore), mechanically scraped ...
-
bioRxiv - Cell Biology 2023Quote: Induction of doxycycline-dependent vectors was performed by addition of 500 ng/ml doxycycline (Merck) every 48 hours ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg H3K27me3 antibody (17-622, Merck-Millipore). For quantitative comparison of CTCF binding between WT and CTCF-AID cells ...
-
bioRxiv - Bioengineering 2021Quote: Three sender area squares (3 × 3 mm) were put into a 24-well containing 300 μL of anti-His antibody (Merck, Germany, NOVG70796-3) (10 μg mL−1 in DPBS ...
-
bioRxiv - Cell Biology 2021Quote: ... Germany) supplemented with 10 % calcium-free foetal bovine serum (S0615, Merck), 2 mmol/l stable glutamine (BioConcept ...
-
bioRxiv - Microbiology 2020Quote: ... 0.005M calcium chloride and 8% sterile egg yolk enrichment (Merck, USA). A 5µl aliquot of C ...
-
bioRxiv - Developmental Biology 2019Quote: ... The cells were blocked in 3% BSA (Applichem) and 5% donkey serum (Merck) in PBS for 2 hours at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... reverse: 5’-CCAGGGTGGAGCGGTC-3’) and the KOD Hot Start Mastermix (Merck, Darmstadt, Germany). The plasmids were confirmed by sequencing (Seqlab ...
-
bioRxiv - Biochemistry 2023Quote: ... PAPS (adenosine 3′-phosphate 5′-phosphosulfate, lithium salt hydrate) was purchased from Merck and stored at -80 °C to afford maximal stability.
-
bioRxiv - Neuroscience 2023Quote: ... The AAV titer was quantified using PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Cell Biology 2020Quote: ... and PBS with magnesium chloride and calcium chloride (Merck KGaA, Darmstadt, Germany). Endothelial cells were isolated by administration of 0.1% collagenase D solution from Clostridium histolyticum (Merck KGaA ...
-
bioRxiv - Microbiology 2020Quote: ... Chelation of intracellular calcium ions was performed using BAPTA-AM (Merck Millipore). 5 µM CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... fully grown oocytes at the GV stage were collected from large antral follicles and released into M2 medium supplemented with 150 μg/ml dibutyryl cyclic (dbc) AMP (Merck KGaA). After being freed from cumulus cells by pipetting ...
-
bioRxiv - Biochemistry 2019Quote: ... and csm5 were cloned into pACYCDuet-1 (5’-NcoI, 3’-XhoI; Novagen, Merck Millipore), csm4 was cloned into pEHisTEV (5’-NcoI ...
-
bioRxiv - Neuroscience 2022Quote: ... with a Chromolith® RP-18 endcapped 5-3 guard cartridges (Merck, Darmstadt, Germany), operated under a flow rate of 0.3 mL/min ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by 3 PBS washes and blocking with 5% bovine serum albumin (BSA; Merck) for 1 hour ...
-
bioRxiv - Cell Biology 2022Quote: ... Ovaries were dissected and oocytes recovered by mouth- pipetting follicles through a narrow glass pipet.Prophase I oocytes were cultured at 38° C in drops of M2 or M16 medium (homemade) supplemented with dbcAMP (dibutyryl cyclic AMP, Sigma Aldrich Merck, D0260) and covered with mineral oil (Sigma-Aldrich Merck ...