Labshake search
Citations for Merck :
1 - 50 of 562 citations for ATF4 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... For the expression of short hairpin RNA (shRNA) we used lentiviral plasmids pLKO.1-ATF4 for ATF4 (TRCN0000301721) with the target sequence: CGGACAAAGATACCTTCGAGT (#SHCLND, Merck) and for non-targeting controls a pLKO.1-plasmid encoding a scrambled sequence (shNTC) ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant rabbit anti-pan-ADP-ribose binding reagent MABE1016 (Merck Millipore) was used 1:1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... BUBR1 (mouse mAb, Merck, MAB3612), CENP-A (mouse mAb ...
-
bioRxiv - Cell Biology 2023Quote: ... tubulin (mouse mAb; Merck, T6199), BUB1 (rabbit pAb ...
-
Developmental effects of oxytocin neurons on social affiliation and processing of social informationbioRxiv - Neuroscience 2021Quote: ... (mouse monoclonal, MAB 318, Merck Millipore).
-
bioRxiv - Bioengineering 2023Quote: ... and lambda IgG1 mAb (Merck, Germany) were used for quantification of ETE IgG1 mAb and DTE IgG1 mAb respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... mAb GAPDH (1:10000; clone Gapdh71.1; Merck), and vinculin (1:500 ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-NeuN (MAB 377, Merck 1:200); rabbit anti-Gfap (Z0334 ...
-
bioRxiv - Microbiology 2023Quote: ... mouse anti-beta-tubulin MAb (Merck: 05-661)) in 5% skim milk in T-PBS buffer at room temperature for 1 hr ...
-
bioRxiv - Bioengineering 2023Quote: ... Commercially available purified kappa IgG1 mAb (Merck, Germany) and lambda IgG1 mAb (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant BG4 (recBG4) (Millipore Merck) was added as control.
-
bioRxiv - Immunology 2022Quote: ... Mouse anti-β-actin mAbs (Merck Millipore, Darmstadt, Germany). Horseradish peroxidase (HRP)-conjugated goat anti-mouse Abs (Abcam Biotechnology) ...
-
bioRxiv - Pathology 2021Quote: ... Mouse anti-phosphoThr mAb clone 20H6.1 (05-1923; Merck Millipore) was used at 1/750 for PLA ...
-
bioRxiv - Neuroscience 2022Quote: ... 1:100 diluted mAb anti-NeuN (Merck Millipore, MAB377, Germany) or 1:100 diluted pAb anti-CXCR3 at 4 °C overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-Nestin mAB (clone rat-401,1:1000, Merck chemicals MAB353), anti-PDH mAb (E1α ...
-
bioRxiv - Cell Biology 2021Quote: ... human recombinant insulin (100 µg/mL; Merck), recombinant human insulin-like growth factor 1 (hIGF1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Recombinant human TNFα (GF023) was from Merck. Purified anti-His tag mouse antibody was from BioLegend (USA) ...
-
Developmental effects of oxytocin neurons on social affiliation and processing of social informationbioRxiv - Neuroscience 2021Quote: ... Primary antibodies used were either mouse anti-TH (MAB 318, Merck Millipore), rabbit anti-EGFP (A11122 ...
-
bioRxiv - Pathology 2021Quote: ... Mouse anti-E2F4 monoclonal antibody (mAb) clone LLF4-2 (MABE160; Merck Millipore) used at 1/400 for PLA ...
-
bioRxiv - Pathology 2022Quote: ... recombinant anti-Cre (Merck Millipore, 69050, 1:1000) and revealed using Histofine reagent (Nichirei Biosciences) ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant active DAPK3 protein was obtained from Merck.
-
bioRxiv - Neuroscience 2020Quote: ... In the case of MBP antibody (Merck Millipore, Germany; Cat. No. MAB 386), after dilution at 1:50 with 0.2% Triton-X 100 for 20 min permeabilization ...
-
bioRxiv - Microbiology 2023Quote: ... The mouse mAb that detects the IAV nucleoprotein was purchased from Merck (MAB8257). Secondary antibodies conjugated to AF405 and AF488 were purchased from Molecular Probes.
-
bioRxiv - Biophysics 2021Quote: ... 6×His-tagged recombinant MSP1E3D1 (Sigma-Aldrich, Merck, USA) and FLAG-tagged recombinant mCardinal (kindly provided by Jakub Czapiński ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 2 μg/ml of recombinant TNC (Merck Millipore) added to the medium ...
-
bioRxiv - Immunology 2021Quote: ... recombinant hepatitis B surface antigen (HBsAg) manufactured by Merck & Co. ...
-
bioRxiv - Biophysics 2020Quote: ... Recombinant DNA reagents and primers were purchased from Merck. As calibration samples in ALEX as well as anisotropy experiments ...
-
bioRxiv - Developmental Biology 2022Quote: ... 10 mg/mL Human recombinant Insulin (Merck, Cat. #91077C) and 1% Pen/Strep ...
-
bioRxiv - Neuroscience 2023Quote: ... Tau ladder (six human tau recombinant isoforms, Sigma-Merck) was used to identify tau isoforms in NCI-H716 cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.1 IU/ml recombinant human FSH (Merck & Co., Inc), 0.125 mg/ml recombinant human hyaluronan (Novozymes) ...
-
bioRxiv - Biochemistry 2023Quote: ... Active recombinant LKB1/STRADα/MO25α was purchased from Merck. Gateway pENTR plasmids encoding full length human BRSK1 & BRSK2 were generated as part of the NIH common fund initiative to Illuminate the Druggable Genome (IDG ...
-
bioRxiv - Neuroscience 2020Quote: ... at 65°C and in MAB solution (maleic acid buffer; Sigma-Aldrich/Merck, Germany) at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... 1:1000 anti-glutamine synthetase (monoclonal mouse, Merck Milipore, MAB 302, clone GS-6), anti-GFAP (goat polyclonal ...
-
bioRxiv - Immunology 2021Quote: ... TILs were then stained with APC anti-mouse IFN-γ mAb clone XMG1.2 (MERCK) and PerCP-Cyanine5.5 anti-mouse TNF-α mAb clone MP6-XT22 (BioLegend) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:1000 anti-glutamine synthetase (monoclonal mouse, Merck Milipore, MAB 302, clone GS-6) or 1:200 anti-oxytocin receptor (polyclonal rabbit ...
-
bioRxiv - Molecular Biology 2019Quote: ... protocol with the administration of recombinant FSH (Gonal-F, Merck Serono ...
-
bioRxiv - Genetics 2020Quote: ... then rhCG (recombinant human chorionic gonadotropin alpha, OVIDREL, Merck Serono) on day 9 Oocytes were collected by laparoscopic follicular aspiration 32–35 h after rhCG administration ...
-
bioRxiv - Biochemistry 2021Quote: ... A complex of recombinant bovine CaM (cat. no. 208690, Merck), with an amino acid sequence identical to the human isoform ...
-
bioRxiv - Developmental Biology 2021Quote: ... Patients were injected with recombinant FSH (Gonal-F, Merck, Italy) on day 2 of their menstrual cycle with a starting dose of 150 IU/d ...
-
bioRxiv - Immunology 2020Quote: ... and recombinant human RAP (Merck Millipore, 200 nM final concentration) were used to stimulate nuclear translocation of MerTK.
-
bioRxiv - Biophysics 2022Quote: Lyophilized recombinant human Chorionic Gonadotropin (hCG) (Chorulon Merck #140-927) is reconstituted with the included sterile 1x PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... of the following ECM proteins: recombinant human fibronectin (Merck, 341631), recombinant human vitronectin (PeproTech ...
-
bioRxiv - Cell Biology 2023Quote: ... Treatments used recombinant human TNFα (10 ng/ml; Merck 654245) and/or LMB (20 ng/ml ...
-
bioRxiv - Immunology 2023Quote: ... The purified mAbs were subsequently subjected to buffer exchange and concentration with AmiconUltra (Merck #36100101).
-
bioRxiv - Developmental Biology 2021Quote: ... and 75 mIU/mL of recombinant follicle stimulating hormone (Merck Serono). The oocytes were randomly assigned to experimental groups ...
-
bioRxiv - Biochemistry 2022Quote: ... Standard curves were generated using recombinant HIV-1 RT (Merck Millipore). The relative viral quantities were calculated based on the standard curve generated using QuantStudio-7 systems software (Applied Biosystems).
-
bioRxiv - Genomics 2019Quote: ... and 100 Units/ml of Recombinant mouse LIF Protein (Merck ESG1107). Culture were seeded at an average density of ∼ 3.8*104 cells/cm2 and passaged every 48 h.
-
bioRxiv - Biochemistry 2020Quote: ... Cell lysates were supplemented with 500 U Recombinant DNAse (Merck 4716728001) and 100 mM PMSF ...
-
bioRxiv - Biochemistry 2022Quote: ... 1000 U/mL recombinant leukemia inhibitory factor (LIF/ESGRO) (Merck Millipore) and 50 U/mL Penicillin–Streptomycin (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2020Quote: ... ESGRO recombinant mouse Leukaemia Inhibitory Factor (LIF) was obtained from Merck Millipore ...