Labshake search
Citations for Merck :
1 - 50 of 5657 citations for 7H Azeto 2 1 b 1 3 dioxino 4 5 e 1 3 oxazin 7 one hexahydro 2 6 dimethyl 2S 4aR 5aS 6S 9aR 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: When the tumor sizes reached to 80 mm3 animals were treated with a PFKFB3 inhibitor 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one) (3PO) (Sigma-Aldrich, Merck, Overijse, Belgium). The animals received intraperitoneal (i.p. ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-alpha tubulin (Merck-SIGMA, clone B-5-1-2) was used as a loading control at 1:10000.
-
bioRxiv - Molecular Biology 2023Quote: ... anti-α-Tubulin (B-5-1-2, Merck Millipore/Sigma) antibodies were purchased ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4 °C overnight on a rolling mixer (30 r.p.m.) ...
-
bioRxiv - Neuroscience 2023Quote: ... at 1/1000 dilution or Laurdan (#40227, 6-Dodecanoyl-N,N-dimethyl-2-naphthylamine, Merck, Sigma-Aldrich) at 1/500 dilution for 30 min at 37°C in the dark ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-cathepsin B (Abcam, ab92955, 1:1,000 and Merck, Ab-3 1:100) and anti-β-actin mouse monoclonal antibody (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... counterstained with 5µg of 4’,6-diamidino-2-phenylindole (DAPI – 1:1) (Sigma/Merck, D9542-10mg) to eliminate dead cells before running through the flow cytometer ...
-
bioRxiv - Cell Biology 2020Quote: ... Primary antibodies used were CYFIP1/2 (Sra-1/PIR121 [14], Rac1/3 (23A8, Merck), Nap1 [14] ...
-
bioRxiv - Cell Biology 2021Quote: ... were applied for one hour at room temperature and cells were counterstained with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI; Merck G8294; 1:3000) before mounting with Fluoromount™.
-
bioRxiv - Systems Biology 2023Quote: ... 4 mL of chloroform:isopropanol 2:1 (v:v)(Merck) were used to elute the neutral lipid fraction (NL) ...
-
bioRxiv - Cell Biology 2023Quote: ... plates were treated with 3-amino-propyltrimethoxysilane (diluted 1:2 with PBS; Sigma-Aldrich/Merck) for 15min at RT ...
-
bioRxiv - Microbiology 2022Quote: ... 2-heptyl-3- hydroxy-4(1H)-quinolone (PQS) (Sigma Aldrich, Merck Life Science ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 x 3’ Neoclear (Merck), 2 x 3 ‘ 100% ETOH ...
-
bioRxiv - Molecular Biology 2019Quote: ... the collagenase inhibitor Ilomastat ((R)-N′-Hydroxy-N-[(S)-2-indol-3-yl-1-(methylcarbamoyl)ethyl]-2-isobutylsuccinamide) (25μM, CC1010, Merck Millipore) or a combination of both ...
-
bioRxiv - Neuroscience 2021Quote: ... 2′,7′-Dichlorofluorescin diacetate (DCFH-DA, Merck, Darmstadt, Germany, 1 mM) dissolved in PBS was added to each well and the plate was placed in the dark for 10 min at room temperature for cell uptake ...
-
bioRxiv - Neuroscience 2022Quote: ... cells nuclei were stained with DAPI (4′,6-diamidino-2-fenilindol, 1:10000, Merck, cat#D9542) for 5 minutes at RT and mounted in Lab Vision™ PermaFluor™ Aqueous Mounting Medium (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then incubated with 4’,6-diamidino-2-phenylindole (DAPI; 1:10,000; Merck Millipore) and mounted on slides with Mowiol (Merck Millipore ...
-
bioRxiv - Biophysics 2023Quote: 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphocholine (DOPC) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) stored in chloroform were purchased from Merck (Darmstadt, Germany) and stored under argon ...
-
bioRxiv - Neuroscience 2023Quote: ... and stained with 5 µM 4′,6-diamidino-2-phenylindole (DAPI) (Merck) in PBS if required ...
-
bioRxiv - Microbiology 2020Quote: Cytotoxicity of the compounds were tested by use of a MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay (Merck) at a final MTT concentration of 0.45 mg/ml or by use of a ATPlite Luminescence Assay System (PerkinElmer ...
-
bioRxiv - Developmental Biology 2023Quote: ... gastruloids were incubated with secondary antibodies and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4°C overnight ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... dried tissue samples (in liquid nitrogen) were dissolved in 3:2:1 mixture of HNO3 (Merck, Germany), H2SO4 (Merck ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Neuroscience 2019Quote: ... 3-octanol (OCT; 1:1000; Merck) and 4-methylcyclohexanol (MCH ...
-
Highly amine-reactive graphene-oxide EM grids for biochemical surface modification in aqueous bufferbioRxiv - Molecular Biology 2023Quote: ... 4-Amino-1-butanol (#178330) and 3- glycidoxypropyltrimethoxysilane (#440167) were obtained from Merck. Gold nanoparticle- PEG-amine conjugate was custom-synthesized by NanoPartz (Loveland CO ...
-
bioRxiv - Neuroscience 2023Quote: Trypsinise Ara-C purified SCs using 1 ml of 6% 2 mg ml-1 Trypsin (Merck - 85450C) in Versene (0.02% EDTA (Thermo Fisher - D/0700/53 ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were mounted in CitiFluor™ CFM3 mounting medium (proSciTech, Australia) containing 3 μg/uL 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Merck, Germany) to stain nucleic acids ...
-
bioRxiv - Immunology 2021Quote: ... either 4′,6-Diamidine-2′-phenylindole dihydrochloride (Merck) or LIVE/DEAD™ Fixable Near-IR stain kit (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... 4′,6-Diamidine-2′-phenylindole dihydrochloride (10236276001, Merck); Dox-NP (300112 ...
-
bioRxiv - Molecular Biology 2020Quote: ... A mixture (2:1 v/v) of (PFA 4% (Merck, 104005) in PBS 1X pH7.4):OCT (Leica Surgipath ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and 0.15% 3-[(3- Cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS, Merck Chemicals Ltd.). NADH:decylubiquinone (DQ) ...
-
bioRxiv - Cell Biology 2022Quote: IBMX (3-Isobutyl-1-Methylxanthin – 15879 - Merck) and lidocaine (L7757 – Merck ...
-
bioRxiv - Immunology 2023Quote: ... the mice were intranasally sensitized using 1 μg of 2′3′-cyclic GMP-AMP (cGAMP, 531889; Merck Darmstadt, Germany) and 1 μg of (HDM ...
-
bioRxiv - Neuroscience 2024Quote: ... for 180 min prior to washing and development in Streptavidin-tertiary reagent (1:500 in 2% BSA and 0.1% Triton [TBS]) conjugated to either Cyanine 3 (Cy3) (Merck) or Alexa Fluor 488 (Life technologies ...
-
bioRxiv - Genomics 2019Quote: ... and mixed with 1 volume of 1-bromo-3-chloropropane (Merck). Samples were spun (2min ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 4.2) and 4-methylumbelliferyl-2-acetamido-2-deoxy-b-D-glucopyranoside (2 mM; #474502, Sigma-Aldrich/Merck). The reaction was stopped by 5 volumes of glycine and Na2CO3 ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 μL of each sample was injected into a Chromolith FastGradient RP 18-e column (50 x 3 x 2 mm; monolithic silica with bimodal pore structure, macropores with 1.6mm diameter; Merck) protected by a precolumn (Gemini NX RP18 ...
-
bioRxiv - Biochemistry 2019Quote: ... and csm5 were cloned into pACYCDuet-1 (5’-NcoI, 3’-XhoI; Novagen, Merck Millipore), csm4 was cloned into pEHisTEV (5’-NcoI ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4′,6-diamidino-2-phenylindole (DAPI; Merck Life Science) 0.1 µg/mL was added to the medium to exclude dead cells.
-
bioRxiv - Cell Biology 2023Quote: ... 4’,6-diamidine-2’-phenylindole dihydrochloride (DAPI) (Merck #10236276001) at a final concentration of 1 µg/ml ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 20 μl, 5 mg/ml, Merck) was added to each well ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of Benzonase (Merck Millipore, US170664-3) was added and samples left on ice until an aqueous solution formed (30 min to 1 h) ...
-
bioRxiv - Neuroscience 2023Quote: For conditioning the odors 4-MCH (1:250, Merck, Darmstadt, Germany,CAS #589-91-3) and 3-OCT (1:167 ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 × 3 min Neo-Clear (Cat. No. 1.09843, Merck), 2 × 3 min 100% ethanol ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with a cocktail of 1:100 phosphatase inhibitors cocktail 2 and 3 (Sigma/Merck, P5726-1ML and P0044-1ML, respectively) and 1:100 protease inhibitor cocktail (Sigma/Merck ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI, #10236276001, Merck) staining ...