Labshake search
Citations for Merck :
1 - 50 of 3594 citations for 7 chloro 5 methylpyrazolo 1 5 A pyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... and CldU 100 μM (5-chloro-2’-deoxyuridine, C6891, MERCK). Cells were embedded in agarose block and DNA was prepared and combed on silanized coverslips ...
-
bioRxiv - Microbiology 2022Quote: ... 4-chloro-7-nitrobenzofurazan (NBD-Cl; Merck, 98%), 1-iodododecane (Merck ...
-
bioRxiv - Molecular Biology 2023Quote: ... exponentially growing RPE-1 cells were pulse-labeled with 1 μM CldU (5-Chloro-2’-deoxyuridine, Merck, C6891) and 250 μM IdU (5-Iodo-2’-deoxyuridine ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
bioRxiv - Plant Biology 2023Quote: ... while 4-chloro-7-nitrobenzoxadiazole (NBD-Cl, 97%, Sigma-Aldrich, Merck Group, St Louis, MO, USA) was applied at 270LgLha−1 of active ingredient ...
-
bioRxiv - Bioengineering 2023Quote: ... 30 mL Expi293 cultures were transfected with HER2 expression plasmid and the supernatant harvested 5-7 days later via centrifugation at 300 G for 5 minutes followed by filtration (Steriflip 0.22mm Merck, SCGP00525). HER2 was then purified from supernatant as previously described (Vazquez-Lombardi et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... Rabbit Aquaporin 5 (Merck, 1:200), Rabbit ERG (Abcam ...
-
bioRxiv - Genetics 2023Quote: ... and 5-methyltetrahydrofolate (5-MTHF, Merck, #M0132) were added to NMG media at indicated concentrations ...
-
bioRxiv - Neuroscience 2023Quote: ... + 5% HS + 5% donkey serum (DS, Merck - D9663) at RT for 1 hour ...
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% DMSO and 5% normal goat serum (Merck) for 1 h at RT and incubated overnight with primary antibodies ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 mM MgCl2 and 5 KU Benzonase nuclease (Merck Millipore) for 30 mins at 4 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were starved overnight in serum-free DMEM and then treated for 1 hour with 5 ng/ml TGFβ1 (Preprotech) or with 5 μM SB431542 (Merck), and intensities quantified by ImageJ ...
-
bioRxiv - Developmental Biology 2023Quote: ... mature pollen was germinated on the surface of solid PGM (18% sucrose, 0.01% H3BO3, 5 mM CaCl2, 5 mM KCl, 1 mM MgSO4 (Merck), pH 7.5 ...
-
bioRxiv - Biophysics 2019Quote: ... 5% glycerol (Merck), 5 mM DTT ...
-
bioRxiv - Neuroscience 2020Quote: ... two custom-made Teflon containers of 5 mm diameter were filled with 10 μl of odor substance (n-amylacetate, AM; CAS: 628-63-7, Merck, Darmstadt ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 mM MgCl2 1 mM DTT and 1× cOmplete protease inhibitor (Merck)] were added and incubated on the rotating wheel for 2 h at 4ºC ...
-
bioRxiv - Plant Biology 2022Quote: ... 13C5-5-MTHF and 13C5-5-FTHF were purchased from Merck Eprova (Schaffhausen ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-alpha tubulin (Merck-SIGMA, clone B-5-1-2) was used as a loading control at 1:10000.
-
bioRxiv - Molecular Biology 2023Quote: ... anti-α-Tubulin (B-5-1-2, Merck Millipore/Sigma) antibodies were purchased ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5% glycerol and 5 mM β-mercaptoethanol) with 0.4 mM Pefabloc (Merck), were disrupted by sonication ...
-
bioRxiv - Immunology 2019Quote: ... WEHI-345 (0, 5 or 10 μM) 23 or Z-YVAD-fmk (0, 1, 5 and 10 μM; 21874; Merck, Australia) for 1 hr prior to stimulation with H ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Developmental Biology 2023Quote: ... 90% and 100% ethanol and 5 min in xylene/ethanol (1:1, Merck) and 5 min in xylene ...
-
bioRxiv - Neuroscience 2019Quote: ... 5% acetic acid (Merck), and dried using SpeedVac (Eppendorf) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 µL Benzonase (Merck) was added and the cells lysed by passing the suspension at least twice through a Microfluidiser (Microfluidics) ...
-
bioRxiv - Pathology 2022Quote: ... 5 mM EDTA (Merck), 0.1 % w/v SDS (Carl Roth) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 mM ATP (MERCK, Sigma Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... 5% Donkey Serum (Merck) in 0.01% PBS-Tween-20 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM H2SO4 (Merck) was used at a flow rate of 0.6 mL/min ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 mM EDTA (Merck), 50 mM Tris pH 8 (Merck) ...
-
bioRxiv - Genomics 2020Quote: ... Keratin 5 (#HPA059479, Merck) and Tubulin beta 4 (#T7941 ...
-
bioRxiv - Neuroscience 2020Quote: ... 5% mercuric chloride (Merck) and 5% potassium chromate (Merck ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 µL Benzonase (Merck) was added and the suspension was stirred thoroughly ...
-
The membrane-cytoplasmic linker defines activity of FtsH proteases in Pseudomonas aeruginosa clone CbioRxiv - Biochemistry 2023Quote: ... 5 µL Benzonase (Merck) and EDTA-free protease inhibitor for 20 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM EDTA (Merck), 50 mM Tris pH 8 (Merck) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5-FU (Merck F6627), Oxaliplatin (Merck O9512) ...
-
bioRxiv - Physiology 2023Quote: ... 5 mM EDTA (Merck), 1 % v/v IGEPAL® CA-630 (Sigma) ...
-
bioRxiv - Immunology 2023Quote: ... 5% Donkey Serum (Merck) in 0.01% PBSTween-20 (PBST) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 mM EDTA (Merck), 0.1 % w/v SDS (Carl Roth) ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% ChemiBLOCKER (Merck Millipore) in 0.1 M NaP ...
-
bioRxiv - Developmental Biology 2020Quote: ... pH 7.4 (Carl Roth),125 mM KCl (Merck),1 mM MgCl2 (Merck),1 mM EGTA/KOH pH 8.0 (Carl Roth),5% glycerol (Merck),1% NP-40 (Nonidet P 40 Substitute ...
-
bioRxiv - Genomics 2021Quote: ... 90 µl 5 M NaCl and 1 µl Pellet Paint (Merck) was added to each sample ...
-
bioRxiv - Genetics 2021Quote: ... 90 µl 5 M NaCl and 1 µl Pellet Paint (Merck) was added to each sample ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were blocked for 1 h with 5% skim milk (Merck) in TBST [50 mM Tris-HCL ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were blocked in 5% BSA TBS-T or 5% skim milk TBS-T and incubated overnight at 4°C with the following primary antibodies diluted in 5 % BSA or 5% skim milk dissolved in TBS-T: pSer293-PDH (1:1,000) (Merck Millipore, Cat. no. ABS204), PDH (1:1,000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and incubated the slides for 5 min in fresh 5% GIEMSA solution (1.09203, Merck) diluted in 100 ml Gurr buffer (10582-013 ...
-
bioRxiv - Molecular Biology 2022Quote: ... was placed on the top of a water-cooled glass column (33 × 2.5 cm) filled with a slurry of silica gel 60 (with the addition of 7 % water, 40 – 63 μm, Merck, Darmstadt, Germany, # 1.09385.2500) and n-pentane ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5 μM rosiglitazone (Merck). After 21 days of exposure to the adipogenic medium ...
-
bioRxiv - Physiology 2019Quote: ... 5 μm particle diameter (Merck) and a “reverse phase column” Acquity UPLC HSS T3 ...