Labshake search
Citations for Merck :
1 - 50 of 4880 citations for 7 Methyl 1 5 dioxo 1 2 3 5 tetrahydro indolizine 6 carbonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 3-(3,5-dioxo-1,2,4-oxadiazolidin-2-yl)-L-alanine (quisqualate) was purchased from Merck (Darmstadt, Germany). AF647-conjugated 9E10 antibody was prepared in-house as described previously (Cook et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-alpha tubulin (Merck-SIGMA, clone B-5-1-2) was used as a loading control at 1:10000.
-
bioRxiv - Molecular Biology 2023Quote: ... anti-α-Tubulin (B-5-1-2, Merck Millipore/Sigma) antibodies were purchased ...
-
bioRxiv - Biochemistry 2023Quote: ... 5(6)-Carboxyfluorescein (CF) (Merck; 100 mM CF stock ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Neuroscience 2023Quote: ... and stained with 5 µM 4′,6-diamidino-2-phenylindole (DAPI) (Merck) in PBS if required ...
-
bioRxiv - Microbiology 2023Quote: ... 1 filter disc (6 mm) impregnated with 5 µM of 30% (v/v) H2O2 (Merck) was placed on the seeded plate ...
-
bioRxiv - Biochemistry 2019Quote: ... and csm5 were cloned into pACYCDuet-1 (5’-NcoI, 3’-XhoI; Novagen, Merck Millipore), csm4 was cloned into pEHisTEV (5’-NcoI ...
-
bioRxiv - Developmental Biology 2022Quote: ... Rabbit Aquaporin 5 (Merck, 1:200), Rabbit ERG (Abcam ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Biochemistry 2021Quote: ... Tetrahydro-folate (THF) was provided from Merck & Cie (Schaffhausen ...
-
bioRxiv - Molecular Biology 2023Quote: ... exponentially growing RPE-1 cells were pulse-labeled with 1 μM CldU (5-Chloro-2’-deoxyuridine, Merck, C6891) and 250 μM IdU (5-Iodo-2’-deoxyuridine ...
-
bioRxiv - Cell Biology 2021Quote: 6 μL of 70 kDa FITC-dextran in EGM-2 (5 mg/mL, Merck, #46945) was added to each vessel ...
-
bioRxiv - Neuroscience 2021Quote: ... 2′,7′-Dichlorofluorescin diacetate (DCFH-DA, Merck, Darmstadt, Germany, 1 mM) dissolved in PBS was added to each well and the plate was placed in the dark for 10 min at room temperature for cell uptake ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... 1-methyl-D-tryptophan (1-DMT; 1-LMT enantiomer, both Merck Life Sciences) for exploration of a possible tryptophan mechanism of immunosuppression ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 20 μl, 5 mg/ml, Merck) was added to each well ...
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% DMSO and 5% normal goat serum (Merck) for 1 h at RT and incubated overnight with primary antibodies ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 and 6 were pooled and concentrated to 1 ml using 10 kDa centrifugal filter (Amicon Ultra-2ml, Merck Millipore ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 mM K4Fe(CN)6 and 1 mg/ml X-gal (Roth)) and counterstained with nuclear fast red (Merck) for 5 min ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Immunology 2022Quote: ... approximately 5×105 Calu-3 cells were pre-treated with kp7-6 (100 ug/mL, CD95/CD95L antagonist, Merck) for 2 hour and then infected with SARS-CoV-2 at an MOI of 0.2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 mM MgCl2 1 mM DTT and 1× cOmplete protease inhibitor (Merck)] were added and incubated on the rotating wheel for 2 h at 4ºC ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Microbiology 2023Quote: ... LB plates were seeded with the different cultures and Whatman n° 1 filter discs (6 mm) were impregnated with 5 μl of 30% (v/v) H2O2 (Merck) as previously described [31] ...
-
bioRxiv - Bioengineering 2023Quote: ... 30 mL Expi293 cultures were transfected with HER2 expression plasmid and the supernatant harvested 5-7 days later via centrifugation at 300 G for 5 minutes followed by filtration (Steriflip 0.22mm Merck, SCGP00525). HER2 was then purified from supernatant as previously described (Vazquez-Lombardi et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4 °C overnight on a rolling mixer (30 r.p.m.) ...
-
bioRxiv - Biochemistry 2022Quote: The matrix 2′,5′-dihydroxyacetophenone (DHAP; Merck) was applied by sublimation and the data were acquired on a modified timsTOF fleX instrument (Bruker Daltonics ...
-
bioRxiv - Developmental Biology 2023Quote: ... 90% and 100% ethanol and 5 min in xylene/ethanol (1:1, Merck) and 5 min in xylene ...
-
bioRxiv - Neuroscience 2020Quote: ... pH 7.4) (final concentration: 12mg/mL) containing 5 μL Benzonase (final concentration: 1 μL benzonase/mL (MERCK, 71205-3). After dissolving ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Cancer Biology 2024Quote: ... counterstained with 5µg of 4’,6-diamidino-2-phenylindole (DAPI – 1:1) (Sigma/Merck, D9542-10mg) to eliminate dead cells before running through the flow cytometer ...
-
bioRxiv - Neuroscience 2023Quote: Trypsinise Ara-C purified SCs using 1 ml of 6% 2 mg ml-1 Trypsin (Merck - 85450C) in Versene (0.02% EDTA (Thermo Fisher - D/0700/53 ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Neuroscience 2022Quote: ... was combined with 90μM sygRNA (5’ - GGATTTGGTAATAGCAG AGGGGG 3’) (Merck) at RT for 15 minutes to form an RNP complex ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA oligonucleotide G4A4 (5’-AAAAAAGGGGAAAAGGGGAAAAGGGGAAAAGGGGAAAAAA-3’) was purchased from Merck. CD analysis of 2,5 µM RNA was carried out in the buffer used for G4-pulldown ...
-
bioRxiv - Microbiology 2021Quote: ... Isolated lipids were dissolved in 30 μL of chloroform:methanol (2:1, v/v) and 5 μL loaded on thin-layer chromatography (TLC) silica gel plates F254 (Merck). Lipids were separated in chloroform/methanol/water (20:4:0.5 ...
-
bioRxiv - Neuroscience 2023Quote: ... they were washed 3 times with 1X PBS for 5 minutes and incubated with DAPI (4’6-Diamidino-2-phenylindole; 1 µg/mL, MERCK) for 5 minutes ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... or 1-octanol was used (1-OCT; CAS: 111-87-5; Merck, Darmstadt, Germany; undiluted). Paraffin is without behavioural significance in larval Drosophila (Saumweber et al ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were starved overnight in serum-free DMEM and then treated for 1 hour with 5 ng/ml TGFβ1 (Preprotech) or with 5 μM SB431542 (Merck), and intensities quantified by ImageJ ...
-
bioRxiv - Developmental Biology 2023Quote: ... mature pollen was germinated on the surface of solid PGM (18% sucrose, 0.01% H3BO3, 5 mM CaCl2, 5 mM KCl, 1 mM MgSO4 (Merck), pH 7.5 ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 μM 6-benzylaminopurine (BAP; Merck Life Science UK Ltd., Gillingham, UK) (0.1% v/v Tween20) ...
-
bioRxiv - Developmental Biology 2020Quote: ... pH 7.4 (Carl Roth),125 mM KCl (Merck),1 mM MgCl2 (Merck),1 mM EGTA/KOH pH 8.0 (Carl Roth),5% glycerol (Merck),1% NP-40 (Nonidet P 40 Substitute ...
-
bioRxiv - Genomics 2021Quote: ... 90 µl 5 M NaCl and 1 µl Pellet Paint (Merck) was added to each sample ...
-
bioRxiv - Genetics 2021Quote: ... 90 µl 5 M NaCl and 1 µl Pellet Paint (Merck) was added to each sample ...