Labshake search
Citations for Merck :
1 - 50 of 5105 citations for 7 8 DIHYDRO 1 3 DIOXOLO 4 5 G ISOQUINOLIN 5 6H ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Bioengineering 2023Quote: ... 30 mL Expi293 cultures were transfected with HER2 expression plasmid and the supernatant harvested 5-7 days later via centrifugation at 300 G for 5 minutes followed by filtration (Steriflip 0.22mm Merck, SCGP00525). HER2 was then purified from supernatant as previously described (Vazquez-Lombardi et al. ...
-
bioRxiv - Microbiology 2022Quote: ... 5 g/l NaCl (Merck), 1 g/l K2HPO4-trihydrate (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Developmental Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Immunology 2024Quote: ... U-937 cells were maintained in RPMI-1640 medium supplemented with 4.5 g/L glucose, 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, 1.0 mM sodium pyruvate (Sigma-Aldrich; Merck KGaA), 10% fetal bovine serum (Hyclone ...
-
bioRxiv - Neuroscience 2022Quote: ... 4-amino pyridine (5 mM, Merck) and TTX (0.5-1 μM ...
-
bioRxiv - Synthetic Biology 2023Quote: ... supplemented with benzonase (5 μL/g pellet, Merck) and incubated for 15 min on a shaking table ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ cyclic mono-phosphate (8-Br-cAMP, Merck B5386) and 1 μM medroxyprogesterone acetate (MPA ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... and mixed 4 g of it in 8 mL of DMSO (Merck). The DMSO-soluble fraction of Enteropan was found to be 71.17% ± 3.07 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: When the tumor sizes reached to 80 mm3 animals were treated with a PFKFB3 inhibitor 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one) (3PO) (Sigma-Aldrich, Merck, Overijse, Belgium). The animals received intraperitoneal (i.p. ...
-
bioRxiv - Microbiology 2020Quote: ... One sterile 5-mm glass bead (Merck KGaA, Darmstadt, Germany) was placed into each well prior to incubation in 37 °C shaking condition (100 rpm ...
-
bioRxiv - Immunology 2022Quote: ... After centrifugation for 5 minutes at 18 000 g the DNA pellet was washed twice with one mL 70% Ethanol (Merck Millipore) followed by 5 minutes centrifugation at 18 000g ...
-
bioRxiv - Microbiology 2019Quote: ... and 5 g/L sodium chloride (Merck, S3014-1kg). Following overnight growth ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Biophysics 2020Quote: ... eluted as one fraction with 80% Acetonitrile and 5% Ammonia (Merck).
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Genomics 2024Quote: ... media was changed for 500 µL of DMEM +5% FBS +4 μg/mL of polybrene (Merck TR-1003-G). Lentiviruses were diluted to the desired MOI in 500 µL of DMEM +5% FBS and slowly added to each well ...
-
bioRxiv - Biochemistry 2019Quote: ... and csm5 were cloned into pACYCDuet-1 (5’-NcoI, 3’-XhoI; Novagen, Merck Millipore), csm4 was cloned into pEHisTEV (5’-NcoI ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Microbiology 2020Quote: ... 5×106 cells from treated and untreated conditions were centrifuged for 5 min at 4,500 g and the pellets were resuspended in 4% paraformaldehyde (PFA, Merck, Germany), and incubated for 20 min ...
-
bioRxiv - Biophysics 2020Quote: ... 50 µl of 5% w/v (145000 g/mol) PVA (Merck) solution in water was spread on a cleaned (rinsed in ethanol and double distilled water ...
-
bioRxiv - Physiology 2021Quote: ... Membranes blocked with 5% non-fat milk in PBS-T or Tris-Buffered Saline TBS (TBS-T) (RT, 60min) and immunoblotted using the following primary antibodies (4°C, overnight): rabbit anti-pSmad1/5/8 (Merck Millipore, AB3848), rabbit anti-pSmad2 (Cell Signaling ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Neuroscience 2022Quote: ... was combined with 90μM sygRNA (5’ - GGATTTGGTAATAGCAG AGGGGG 3’) (Merck) at RT for 15 minutes to form an RNP complex ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA oligonucleotide G4A4 (5’-AAAAAAGGGGAAAAGGGGAAAAGGGGAAAAGGGGAAAAAA-3’) was purchased from Merck. CD analysis of 2,5 µM RNA was carried out in the buffer used for G4-pulldown ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were harvested by centrifugation at 5,000 × g and 4°C for 5 min and lysed with BugBuster Protein Extraction Reagent (Merck Millipore, Burlington, MA) prepared in 20 mM sodium phosphate buffer (pH 7.4 ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 8) and permeabilized and blocked with 1X TBS supplemented with 1% Triton-X100 (MERCK; Cat #9036-19-5) and 6% FBS (Biological Industries ...
-
bioRxiv - Cell Biology 2021Quote: ... After blocking for one hour in PBST with 5% normal goat serum (Merck G9023) and 0.1% BSA ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Rabbit Aquaporin 5 (Merck, 1:200), Rabbit ERG (Abcam ...
-
bioRxiv - Biochemistry 2019Quote: ... The cell pellet was resuspended in Bug-Buster (5 mL/g pellet, Merck) supplemented with benzonase 5 µL/g pellet ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The pelleted cells were subsequently resuspended in BugBuster (5 mL/g pellet, Merck) supplemented with benzonase (5 μL/g pellet ...
-
bioRxiv - Cell Biology 2022Quote: ... 4 g PFA (Merck) was dissolved in 80 ml PBS heated to 60 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... The blots were developed in a solution of nitroblue tetrazolium chloride (NBT) and 5-brom-4-chlor-3-indoxylphosphate (BCIP; Merck, Darmstadt, Germany) for 5–30 min at RT ...
-
bioRxiv - Developmental Biology 2019Quote: ... The cells were passaged per 3–5 days using Accutase (Merck-Millipore), mechanically scraped ...
-
bioRxiv - Genetics 2023Quote: ... and 5-methyltetrahydrofolate (5-MTHF, Merck, #M0132) were added to NMG media at indicated concentrations ...
-
bioRxiv - Neuroscience 2022Quote: ... with PBS pH 7.4 for 10 min at 4400 x g and 4°C using an Amicon Ultra-4 concentrator with 3 kDa cutoff (Merck Millipore). The degree of labelling (DOL = 1.96 ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Biophysics 2020Quote: ... one cycle for 5 min) in Amicon Ultra 100 kDa MWCO filters (Merck Millipore, Darmstadt, Germany) using reaction buffer (25 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Cell Biology 2020Quote: ... and subsequently washed 4 times in Quencher solution (5 mM Trolox (Merck), 10 mM Na-Ascorbate (Merck)) ...
-
bioRxiv - Neuroscience 2023Quote: ... and stained with 5 µM 4′,6-diamidino-2-phenylindole (DAPI) (Merck) in PBS if required ...
-
bioRxiv - Cell Biology 2019Quote: ... cleared extracts were incubated 2h-6h at +4°C in an orbital shaker with anti-FLAG sepharose beads (M2 clone, Merck, A2220). Bound complexes were pelleted and 5x washed (Lysis buffer with 1M NaCl) ...
-
bioRxiv - Developmental Biology 2019Quote: ... The cells were blocked in 3% BSA (Applichem) and 5% donkey serum (Merck) in PBS for 2 hours at RT ...