Labshake search
Citations for Merck :
1 - 50 of 2419 citations for 6H Thieno 2 3 b pyrrole 5 carboxylicacid ethyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: Pyrrole (C4H5N) 98.0% (Merck, Germany) was vacuum distilled before use ...
-
bioRxiv - Molecular Biology 2019Quote: ... the collagenase inhibitor Ilomastat ((R)-N′-Hydroxy-N-[(S)-2-indol-3-yl-1-(methylcarbamoyl)ethyl]-2-isobutylsuccinamide) (25μM, CC1010, Merck Millipore) or a combination of both ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-alpha tubulin (Merck-SIGMA, clone B-5-1-2) was used as a loading control at 1:10000.
-
bioRxiv - Molecular Biology 2023Quote: ... anti-α-Tubulin (B-5-1-2, Merck Millipore/Sigma) antibodies were purchased ...
-
bioRxiv - Biochemistry 2023Quote: ... Reaction was started by the addition of 10 mM Nα-Benzoyl-L-arginine ethyl ester hydrochloride (BAEE, Merck). After 30 min the reaction was quenched with EDTA (50 mM final concentration) ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2022Quote: ... membrane-impermeant Cy®5 Mono NHS Ester (Merck / Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... the cells were discarded and N-ethyl-maleimide (Merck, 2 mM) and Pefabloc (Roth ...
-
bioRxiv - Cell Biology 2023Quote: ... containing 0.17mg/ml tricaine (ethyl-3-aminobenzoatemethanesulfonate, ref. n°E10521, Merck/Sigma-Aldrich). WM983B cells of different lysosome clustering status (spread ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... namely using 1 g/L MS-222 (Ethyl 3-aminobenzoate methanesulfonate, Merck #E10521) and subsequent exsanguination by cutting the gill arches ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... ethyl acetate p.a (Merck), KBr Pro spectrophotometry ...
-
bioRxiv - Immunology 2022Quote: [12C4]-ethyl acetoacetate (Merck) and [13C4]-ethyl-acetoacetate (Cambridge Isotope labs ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Biophysics 2021Quote: ... 6h) and purified using 100kDa Amicon ®Ultra centrifugal filters (UFC510096, Merck). DNA origami were stored up to 4 weeks at -20°C.
-
bioRxiv - Biophysics 2020Quote: ... 6h) and purified using 100kDa Amicon®Ultra centrifugal filters (UFC510096, Merck). DNA origami were stored up to 4 weeks at −20°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... by submersion in 160 mg/l MS-222 (ethyl 3-aminobenzoate methanesulfonate; Sigma-Aldrich, Merck, Darmstadt, Germany) dissolved in tank water ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 20 μl, 5 mg/ml, Merck) was added to each well ...
-
bioRxiv - Immunology 2023Quote: ... Pepstatin A Methyl Ester (Pepstatin A, 516485) and MCC950 (256373-96-3) were purchased from Merck. Ultrapure™ DNase/RNase-Free Distilled Water (10977035 ...
-
bioRxiv - Neuroscience 2021Quote: Ethyl alcohol was purchased from Merck Chemicals (Darmstadt ...
-
bioRxiv - Neuroscience 2023Quote: Ethyl alcohol (Merck Chemicals, Darmstadt, Germany) was diluted in tap water to obtain a 20% (v/v ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Immunology 2023Quote: ... Staphylococcus-Enterotoxin-B (SEB) (5 µg/ml, Merck Sigma-Aldrich), DAPI (Merck Sigma-Aldrich) ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 x 3’ Neoclear (Merck), 2 x 3 ‘ 100% ETOH ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Evolutionary Biology 2020Quote: Larvae were raised as described above until 11 dpf and deeply anesthetized with 160 mg/l of Tricaine (Ethyl 3-aminobenzoate methanesulfonate salt, MS-222, Merck) before dissecting their pectoral fins ...
-
bioRxiv - Developmental Biology 2023Quote: ... Product number E4250) (1 mg/ml) to contract pigment cells alongside 0.01% Tricaine (Ethyl 3-aminobenzoate methanesulfonate, Sigma-Aldrich (Merck) Product number E10521 ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 4.2) and 4-methylumbelliferyl-2-acetamido-2-deoxy-b-D-glucopyranoside (2 mM; #474502, Sigma-Aldrich/Merck). The reaction was stopped by 5 volumes of glycine and Na2CO3 ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-cathepsin B (Abcam, ab92955, 1:1,000 and Merck, Ab-3 1:100) and anti-β-actin mouse monoclonal antibody (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: Aldicarb and paraoxon-ethyl were acquired from Merck. Aldicarb was dissolved in 70% ethanol and paraoxon-ethyl was dissolved in 100% DMSO ...
-
bioRxiv - Microbiology 2020Quote: ... followed by a mid-filter of 5 μm pore size (Mixed cellulose ester membrane filter; Merck Millipore, USA) and finally through a 0.22 μm collection filter (Cellulose mixed ester membrane filter ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Microbiology 2020Quote: ... Mixed cellulose ester filter discs (Merck Millipore) were placed on the surface of M9 agar plates and coated with the diluted cell suspensions ...
-
bioRxiv - Microbiology 2021Quote: ... Mixed cellulose ester filter discs (Merck Millipore) were placed on the surface of M9 agar plates and coated with the diluted cell suspensions ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Cell Biology 2020Quote: ... at a final concentration of 5 μg/ml or Latrunculin B (428020-1MG, Merck) at a final concentration of 5 μM in M2 medium supplemented with dbcAMP ...
-
bioRxiv - Biochemistry 2023Quote: ... hexane and ethyl acetate were purchased from Merck (Darmstadt, Germany). Tween 20 ...
-
bioRxiv - Biochemistry 2022Quote: The matrix 2′,5′-dihydroxyacetophenone (DHAP; Merck) was applied by sublimation and the data were acquired on a modified timsTOF fleX instrument (Bruker Daltonics ...
-
bioRxiv - Molecular Biology 2024Quote: ... fixed with 2% paraformaldehyde (PFA) in PHEM and washed once for 5 min at (RT) with 3% BSA (bovine serum albumin, Merck-Sigma, Germany) in Tris-buffered saline with 10 mM EGTA and 2 mM MgCl2 (TBSTEM) ...
-
bioRxiv - Microbiology 2021Quote: ... NHS-ester staining: the gel was placed in a 6 well plate and incubated in 594 NHS-ester (Merck, 08741) diluted at 10 μg/mL in 3 ml PBS for 1 hour and 30 minutes at room temperature on a rocking platform ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 × 3 min Neo-Clear (Cat. No. 1.09843, Merck), 2 × 3 min 100% ethanol ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...