Labshake search
Citations for Merck :
1 - 50 of 3530 citations for 6H 5 Oxa 1 2a 4a triazacyclopenta cd pentalene 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... MeFox (pyrazino-s-triazine derivative of 4a-hydroxy-5-methyltetrahydrofolate) was purchased from Merck & Cie (Schaffhausen ...
-
bioRxiv - Biophysics 2021Quote: ... 6h) and purified using 100kDa Amicon ®Ultra centrifugal filters (UFC510096, Merck). DNA origami were stored up to 4 weeks at -20°C.
-
bioRxiv - Biophysics 2020Quote: ... 6h) and purified using 100kDa Amicon®Ultra centrifugal filters (UFC510096, Merck). DNA origami were stored up to 4 weeks at −20°C ...
-
bioRxiv - Neuroscience 2019Quote: ... and rabbit anti-2A peptide (Merck Millipore ABS31, 1:2000). All corresponding secondary antibodies were from ThermoFisher/Life technologies or Jackson ImmunoResearch laboratories ...
-
bioRxiv - Cancer Biology 2021Quote: ... # HS0000050421 and control lentiviral particles (U6-gRNA/EF1a-puro-2A-Cas9-2A-GFP) were purchased from Merck/Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... CT-2A (mouse glioma cells (SCC194, Merck)) ...
-
bioRxiv - Plant Biology 2022Quote: ... the CDS of wild type (WT) PpGS1b.1 and PpGS1b.2 were subcloned into pET30a vector (Merck, Darmstadt, Germany) including a N-terminal 6xHis-tag by PCR ...
-
bioRxiv - Neuroscience 2022Quote: Rabies injected brains were immunohistochemically stained using antibodies against the 2A linker protein (Merck/ Millipore, ABS31, 1:2000) found in tTA expressing cells ...
-
bioRxiv - Cell Biology 2019Quote: ... cleared extracts were incubated 2h-6h at +4°C in an orbital shaker with anti-FLAG sepharose beads (M2 clone, Merck, A2220). Bound complexes were pelleted and 5x washed (Lysis buffer with 1M NaCl) ...
-
bioRxiv - Microbiology 2023Quote: ... these cultures were diluted 100x in the appropriate medium and either spotted on a sealed agarose pad (MOPS medium, 2% agarose, Figure 1D-F & 4A) or loaded in a CellASIC Onix plate (Merck) and perfused with MOPS medium containing 0.4% arabinose and 20 μg/ml chloramphenicol at 34.5 psi (Figure 3A & 5C) ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were incubated for 1 h at RT with a mouse anti-2A primary antibody (cat. no. MABS2005, Merck) diluted 1:2000 in 1% (w/v ...
-
bioRxiv - Developmental Biology 2022Quote: ... Rabbit Aquaporin 5 (Merck, 1:200), Rabbit ERG (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% DMSO and 5% normal goat serum (Merck) for 1 h at RT and incubated overnight with primary antibodies ...
-
bioRxiv - Microbiology 2021Quote: ... Mycelia cultured for 24 h in CD medium were collected by filtering through Miracloth (Merck Millipore, Darmstadt, Germany), washed with water ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 mM MgCl2 1 mM DTT and 1× cOmplete protease inhibitor (Merck)] were added and incubated on the rotating wheel for 2 h at 4ºC ...
-
bioRxiv - Developmental Biology 2023Quote: ... 90% and 100% ethanol and 5 min in xylene/ethanol (1:1, Merck) and 5 min in xylene ...
-
bioRxiv - Immunology 2022Quote: ... Animals were randomly assigned to be treated with either 170,000 IU/kg human recombinant interferon alpha-2a (Merck), or BSA/saline (0.9% NaCl ...
-
bioRxiv - Microbiology 2023Quote: ... and matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) mass spectrometry (MS) and circular dichroism (CD) spectroscopy analyses were of HPLC reagent grade and purchased from Merck KGaA (Darmstadt ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-alpha tubulin (Merck-SIGMA, clone B-5-1-2) was used as a loading control at 1:10000.
-
bioRxiv - Molecular Biology 2023Quote: ... anti-α-Tubulin (B-5-1-2, Merck Millipore/Sigma) antibodies were purchased ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... or 1-octanol was used (1-OCT; CAS: 111-87-5; Merck, Darmstadt, Germany; undiluted). Paraffin is without behavioural significance in larval Drosophila (Saumweber et al ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were starved overnight in serum-free DMEM and then treated for 1 hour with 5 ng/ml TGFβ1 (Preprotech) or with 5 μM SB431542 (Merck), and intensities quantified by ImageJ ...
-
bioRxiv - Developmental Biology 2023Quote: ... mature pollen was germinated on the surface of solid PGM (18% sucrose, 0.01% H3BO3, 5 mM CaCl2, 5 mM KCl, 1 mM MgSO4 (Merck), pH 7.5 ...
-
bioRxiv - Cell Biology 2019Quote: Hela cells were transiently transfected with pSpCas9(BB)-2A-GFP (PX458)(83) encoding sgRNAs targeting VPS41 using X-tremeGENE (Merck) according to the manufacturers recommendation ...
-
bioRxiv - Developmental Biology 2020Quote: ... pH 7.4 (Carl Roth),125 mM KCl (Merck),1 mM MgCl2 (Merck),1 mM EGTA/KOH pH 8.0 (Carl Roth),5% glycerol (Merck),1% NP-40 (Nonidet P 40 Substitute ...
-
bioRxiv - Genomics 2021Quote: ... 90 µl 5 M NaCl and 1 µl Pellet Paint (Merck) was added to each sample ...
-
bioRxiv - Genetics 2021Quote: ... 90 µl 5 M NaCl and 1 µl Pellet Paint (Merck) was added to each sample ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were blocked for 1 h with 5% skim milk (Merck) in TBST [50 mM Tris-HCL ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5 U ml−1 penicillin and 50 μg ml−1 streptomycin (Merck Life Science (Sigma)) at 37 °C and 5% CO2 ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Negative control lines ‘NC’ and ‘NC#2’ were generated with U6gRNA-pCMV-Cas9–2A-GFP containing the guide tatgtgcggcaaaccaagcg (CRISPR08; Sigma-Aldrich/Merck). For three days prior to transfection ...
-
bioRxiv - Immunology 2019Quote: ... WEHI-345 (0, 5 or 10 μM) 23 or Z-YVAD-fmk (0, 1, 5 and 10 μM; 21874; Merck, Australia) for 1 hr prior to stimulation with H ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... 1 nM 3,3′,5-Triiodo-L-thyronine sodium salt (Merck, cat. #T6397), and 1% penicillin-streptomycin (Merck ...
-
bioRxiv - Molecular Biology 2023Quote: ... exponentially growing RPE-1 cells were pulse-labeled with 1 μM CldU (5-Chloro-2’-deoxyuridine, Merck, C6891) and 250 μM IdU (5-Iodo-2’-deoxyuridine ...
-
bioRxiv - Cancer Biology 2020Quote: ... Methanol extracts were diluted 1:5 in Milli-Q water (Merck, Darmstadt, Germany) and subjected to reversed phase HPLC-MS using an Accela 1250 HPLC system equipped with a Hypersil Gold aQ column and coupled to a QExactiveTM mass spectrometer (all from Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 mM β-mercaptoethanol and 1% (v/v) complete protease inhibitor cocktail (Merck). The protein concentration was quantified in crude extracts with the Bradford assay (Bradford ...
-
bioRxiv - Physiology 2024Quote: ... Mice also received Prednisolon (1 mg/kg diluted in 5 % glucose i.p., Merck) up to 10 days post-surgery to reduce the potential immune response to the LV-vectors.
-
bioRxiv - Genetics 2023Quote: ... and 5-methyltetrahydrofolate (5-MTHF, Merck, #M0132) were added to NMG media at indicated concentrations ...
-
bioRxiv - Microbiology 2023Quote: ... the supernatant was discarded and aliquots (20 μL) of the remaining solution (500 μL) were plated on solid Reasoner’s 2A (R2A; Sigma-Aldrich, Merck, Rahway, NJ, USA) to confirm the absence of bacterial growth seven days after incubation at 25°C.
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were blocked in 5% BSA TBS-T or 5% skim milk TBS-T and incubated overnight at 4°C with the following primary antibodies diluted in 5 % BSA or 5% skim milk dissolved in TBS-T: pSer293-PDH (1:1,000) (Merck Millipore, Cat. no. ABS204), PDH (1:1,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... + 5% HS + 5% donkey serum (DS, Merck - D9663) at RT for 1 hour ...
-
bioRxiv - Biochemistry 2019Quote: ... and csm5 were cloned into pACYCDuet-1 (5’-NcoI, 3’-XhoI; Novagen, Merck Millipore), csm4 was cloned into pEHisTEV (5’-NcoI ...
-
bioRxiv - Biophysics 2022Quote: HEK293T cells were cultured in 10 cm tissue culture treated dishes grown at 37 °C in a 5% CO2 atmosphere in HEPES buffered DMEM/F12 1:1 (Merck) supplemented with 10% fetal bovine serum and 2 mM L-glutamine ...
-
bioRxiv - Immunology 2023Quote: ... peptides were dissolved at a concentration of 1 to 5 mg ml-1 in 1x PBS and incubated with TCEP agarose CL4-B (Merck) for 1 hour to reduce paired cysteines ...
-
bioRxiv - Microbiology 2023Quote: ... 1 filter disc (6 mm) impregnated with 5 µM of 30% (v/v) H2O2 (Merck) was placed on the seeded plate ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were blocked in 5% skim milk in TBS for 1 hour and probed with mouse γ/9d 2G10.2 (1:1000, MERCK MABT1335), rabbit anti mouse IgG (1:3000 ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 mM MgCl2 and 5 KU Benzonase nuclease (Merck Millipore) for 30 mins at 4 °C ...
-
bioRxiv - Biophysics 2019Quote: ... 5% glycerol (Merck), 5 mM DTT ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 50 μL magnetic beads were incubated with 5 μg of Ago-1 antibody (Merck, Millipore, Germany) or IgG antibody (Merck ...