Labshake search
Citations for Merck :
1 - 50 of 5207 citations for 6H 1 3 Dioxolo 4 5 g 1 benzopyran 6 one 7 8 dihydro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: When the tumor sizes reached to 80 mm3 animals were treated with a PFKFB3 inhibitor 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one) (3PO) (Sigma-Aldrich, Merck, Overijse, Belgium). The animals received intraperitoneal (i.p. ...
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were stained with DAPI before mounting with Mowiol (12 mL of 0.2 M Tris buffer pH8.5, 6 mL distilled water, 6 g glycerol, 2.4 g Mowiol 4-88, Merck Millipore).
-
bioRxiv - Neuroscience 2023Quote: ... Coverslips were shortly rinsed in distilled water and mounted using Mowiöl (12 ml of 0.2 M Tris buffer, 6 ml distilled water, 6 g glycerol, 2.4 g Mowiol 4-88, Merck Millipore). Samples were imaged directly or within the next 48h ...
-
bioRxiv - Microbiology 2024Quote: ... and mixed 4 g of it in 8 mL of DMSO (Merck). The DMSO-soluble fraction of Enteropan was found to be 71.17% ± 3.07 ...
-
bioRxiv - Microbiology 2023Quote: ... containing solid (7 g L−1 agar) full-strength Hoagland (2.75 mL well−1; pH adjusted to 6.5) (Sigma-Aldrich, Merck), sealed with parafilm and placed under the growth chamber ...
-
bioRxiv - Cell Biology 2021Quote: ... were applied for one hour at room temperature and cells were counterstained with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI; Merck G8294; 1:3000) before mounting with Fluoromount™.
-
bioRxiv - Developmental Biology 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4 °C overnight on a rolling mixer (30 r.p.m.) ...
-
bioRxiv - Cancer Biology 2024Quote: ... counterstained with 5µg of 4’,6-diamidino-2-phenylindole (DAPI – 1:1) (Sigma/Merck, D9542-10mg) to eliminate dead cells before running through the flow cytometer ...
-
bioRxiv - Genetics 2022Quote: ... 4 serial 10-fold dilutions of the viral stock were applied to each well of a 6-well mESC plate (MOCK plus 10−3 to 10−6) for transduction with 8 ng/μl polybrene (Merck). Two replicates were generated for each well ...
-
bioRxiv - Immunology 2024Quote: ... U-937 cells were maintained in RPMI-1640 medium supplemented with 4.5 g/L glucose, 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, 1.0 mM sodium pyruvate (Sigma-Aldrich; Merck KGaA), 10% fetal bovine serum (Hyclone ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... namely using 1 g/L MS-222 (Ethyl 3-aminobenzoate methanesulfonate, Merck #E10521) and subsequent exsanguination by cutting the gill arches ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...
-
bioRxiv - Bioengineering 2023Quote: ... 30 mL Expi293 cultures were transfected with HER2 expression plasmid and the supernatant harvested 5-7 days later via centrifugation at 300 G for 5 minutes followed by filtration (Steriflip 0.22mm Merck, SCGP00525). HER2 was then purified from supernatant as previously described (Vazquez-Lombardi et al. ...
-
bioRxiv - Immunology 2023Quote: ... WT mice were 7-8 week-old Mice (C57BL/6 WT or Nr4a3-Timer-GS) were injected with 10 mg/kg azoxymethane (Merck) via i.p ...
-
bioRxiv - Neuroscience 2023Quote: ... and stained with 5 µM 4′,6-diamidino-2-phenylindole (DAPI) (Merck) in PBS if required ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
Highly amine-reactive graphene-oxide EM grids for biochemical surface modification in aqueous bufferbioRxiv - Molecular Biology 2023Quote: ... 4-Amino-1-butanol (#178330) and 3- glycidoxypropyltrimethoxysilane (#440167) were obtained from Merck. Gold nanoparticle- PEG-amine conjugate was custom-synthesized by NanoPartz (Loveland CO ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transduced with 1 MOI of concentrated virus containing 8 ug/mL Polybrene (Merck, TR-1003-G). Two days later ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: OCT-embedded penis sections from humans and rats of 6-8 μm were cut in a cryostat and incubated with or without 4-Hydroxi-TEMPO (4-TEMPOL; Merck, Darmstadt, Germany) 10mM for 30 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... The media was replaced after 24 hours with 1 mL growth media mixed with 1 mL of virus media and 8 μg/mL of Polybrene (Merck Millipore, TR-1003-G). One day later ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng G-CASE and 3 mL PEI solution (1 mg/mL) (Merck KGaA, Darmstadt, Germany). 100 µL transfected cells were seeded per well onto 96-well plates (Brand ...
-
bioRxiv - Cell Biology 2022Quote: ... 4 g PFA (Merck) was dissolved in 80 ml PBS heated to 60 °C ...
-
bioRxiv - Microbiology 2023Quote: ... 1 filter disc (6 mm) impregnated with 5 µM of 30% (v/v) H2O2 (Merck) was placed on the seeded plate ...
-
bioRxiv - Neuroscience 2022Quote: ... cells nuclei were stained with DAPI (4′,6-diamidino-2-fenilindol, 1:10000, Merck, cat#D9542) for 5 minutes at RT and mounted in Lab Vision™ PermaFluor™ Aqueous Mounting Medium (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then incubated with 4’,6-diamidino-2-phenylindole (DAPI; 1:10,000; Merck Millipore) and mounted on slides with Mowiol (Merck Millipore ...
-
bioRxiv - Biochemistry 2019Quote: ... and csm5 were cloned into pACYCDuet-1 (5’-NcoI, 3’-XhoI; Novagen, Merck Millipore), csm4 was cloned into pEHisTEV (5’-NcoI ...
-
bioRxiv - Biophysics 2022Quote: ... NaCl (40 g) and KCl (1 g) procured from Merck.
-
bioRxiv - Cancer Biology 2022Quote: ... and additional wells with 20% biotinylated PLL-g-PEG and FNIII(7-10) were supplemented with 1 µM staurosporine (Merck Millipore) to serve as a positive control for apoptosis ...
-
bioRxiv - Neuroscience 2022Quote: ... with PBS pH 7.4 for 10 min at 4400 x g and 4°C using an Amicon Ultra-4 concentrator with 3 kDa cutoff (Merck Millipore). The degree of labelling (DOL = 1.96 ...
-
bioRxiv - Neuroscience 2023Quote: For conditioning the odors 4-MCH (1:250, Merck, Darmstadt, Germany,CAS #589-91-3) and 3-OCT (1:167 ...
-
bioRxiv - Cell Biology 2019Quote: ... cleared extracts were incubated 2h-6h at +4°C in an orbital shaker with anti-FLAG sepharose beads (M2 clone, Merck, A2220). Bound complexes were pelleted and 5x washed (Lysis buffer with 1M NaCl) ...
-
bioRxiv - Developmental Biology 2023Quote: ... gastruloids were incubated with secondary antibodies and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4°C overnight ...
-
bioRxiv - Microbiology 2021Quote: ... was cultured in high-glucose (4.5 g × ml−1) Dulbecco’s modified Eagle’s medium (DMEM) containing 4 mM stable glutamine (Merck) and supplemented with 6% inactivated fetal calf serum (iFCS ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transduced with sgRNA lentiviruses at an MOI of 3 with 8 µg ml−1 Polybrene (Merck-Millipore) for 4 hours and then reprogramming was initiated by addition of reprogramming medium ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
bioRxiv - Microbiology 2022Quote: ... 4-chloro-7-nitrobenzofurazan (NBD-Cl; Merck, 98%), 1-iodododecane (Merck ...
-
bioRxiv - Biochemistry 2023Quote: ... 5(6)-Carboxyfluorescein (CF) (Merck; 100 mM CF stock ...
-
bioRxiv - Molecular Biology 2023Quote: ... then the mixture was dialyzed against histone refolding buffer at 4 □ using a dialysis tube (D-TubeTM Dialyzer Medi or Maxi, MWCO 6-8 kDa, Merck). HE buffer (10 mM HEPES ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-Mad1 clone BB3-8 (1:1000, Merck), anti-ZW10 (Rabbit ...
-
bioRxiv - Microbiology 2022Quote: ... 5 g/l NaCl (Merck), 1 g/l K2HPO4-trihydrate (Thermo Fisher ...
-
bioRxiv - Biochemistry 2020Quote: ... Prepared solutions were mixed at 3:1 ratio with 20% α-cyano-4-hydroxycinnamic acid (Merck) solution in 20% ACN ...
-
bioRxiv - Immunology 2024Quote: 7-8 weeks old mice were injected intraperitoneally with azoxymethane (AOM, Merck) dissolved in isotonic saline solution at a concentration of 10 mg/kg body weight ...
-
bioRxiv - Immunology 2023Quote: 7-8 weeks old mice were injected intraperitoneally with azoxymethane (AOM, Merck) dissolved in isotonic saline solution at a concentration of 10 mg/kg body weight ...
-
bioRxiv - Microbiology 2020Quote: ... and 20 g L-1 glucose (Merck) as sole carbon source ...
-
bioRxiv - Neuroscience 2020Quote: ... The cortices were homogenized mechanically in PBS by pipetting up and down with a 5mL plastic pipette, centrifuged (500 x g, 7 min, 4 °C) and resuspended in DMEM (Sigma-Aldrich, Merck, Switzerland) containing 5% FCS (Biochrom ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 8) and permeabilized and blocked with 1X TBS supplemented with 1% Triton-X100 (MERCK; Cat #9036-19-5) and 6% FBS (Biological Industries ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 4 g/l thiamine-HCl (Merck), and 40 g/l myo-inositol (Merck) ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-HA-7 (Merck H9658; RRID:AB_260092; WB 1:20000) mouse anti-T7-tag (Merck 69522 ...
-
bioRxiv - Cell Biology 2020Quote: ... TE-7 (mouse, 1:200, Cat nb CBBL271, Merck, Sigma), Pax7 (mouse ...