Labshake search
Citations for Merck :
1 - 50 of 4287 citations for 6H 1 3 5 Trioxepino 6 7 f benzimidazole 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 5(6)-Carboxyfluorescein (CF) (Merck; 100 mM CF stock ...
-
bioRxiv - Biophysics 2021Quote: ... 6h) and purified using 100kDa Amicon ®Ultra centrifugal filters (UFC510096, Merck). DNA origami were stored up to 4 weeks at -20°C.
-
bioRxiv - Biophysics 2020Quote: ... 6h) and purified using 100kDa Amicon®Ultra centrifugal filters (UFC510096, Merck). DNA origami were stored up to 4 weeks at −20°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Immunology 2022Quote: ... approximately 5×105 Calu-3 cells were pre-treated with kp7-6 (100 ug/mL, CD95/CD95L antagonist, Merck) for 2 hour and then infected with SARS-CoV-2 at an MOI of 0.2 ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Microbiology 2023Quote: ... 1 filter disc (6 mm) impregnated with 5 µM of 30% (v/v) H2O2 (Merck) was placed on the seeded plate ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Biochemistry 2019Quote: ... and csm5 were cloned into pACYCDuet-1 (5’-NcoI, 3’-XhoI; Novagen, Merck Millipore), csm4 was cloned into pEHisTEV (5’-NcoI ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Neuroscience 2022Quote: ... They were recorded in the presence of 10 mM CNQX (6-cyano-7-nitroquinoxaline-2,3-dione, Merck) and 50 mM D-AP5 (D-2-amino-5-phosphonovalerate ...
-
bioRxiv - Physiology 2023Quote: ... Blots were washed 3 x for 7 min with TBS-T (200 mM Tris (Merck), 1.36 mM NaCl (Merck) ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Genetics 2022Quote: ... 4 serial 10-fold dilutions of the viral stock were applied to each well of a 6-well mESC plate (MOCK plus 10−3 to 10−6) for transduction with 8 ng/μl polybrene (Merck). Two replicates were generated for each well ...
-
bioRxiv - Cancer Biology 2024Quote: ... Only treatment naive patients that underwent anti-PD-1 monotherapy with either pembrolizumab (200 mg IV every 3 weeks or 400 mg IV every 6 weeks, Merck) or nivolumab (240 mg IV every 2 weeks or 480 mg IV every 4 weeks ...
-
bioRxiv - Bioengineering 2023Quote: ... 30 mL Expi293 cultures were transfected with HER2 expression plasmid and the supernatant harvested 5-7 days later via centrifugation at 300 G for 5 minutes followed by filtration (Steriflip 0.22mm Merck, SCGP00525). HER2 was then purified from supernatant as previously described (Vazquez-Lombardi et al. ...
-
bioRxiv - Neuroscience 2022Quote: 6-7 dpf zebrafish larvæ were deeply anesthetized using 0.2% Ethyl3-aminobenzoate methanesulfonate (MS222; Merck KGaA, Darmstadt, Germany) diluted in EM ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Microbiology 2023Quote: ... We used sterile-filtered 3 % bovine serum albumin (BSA heat shock fraction, pH 7, > 98 %, Merck) in 1 × Pierce PBS buffer (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 and 6 were pooled and concentrated to 1 ml using 10 kDa centrifugal filter (Amicon Ultra-2ml, Merck Millipore ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 mM K4Fe(CN)6 and 1 mg/ml X-gal (Roth)) and counterstained with nuclear fast red (Merck) for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... and stained with 5 µM 4′,6-diamidino-2-phenylindole (DAPI) (Merck) in PBS if required ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 μM 6-benzylaminopurine (BAP; Merck Life Science UK Ltd., Gillingham, UK) (0.1% v/v Tween20) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pH 7 using repetitive washing and centrifugation with an Amicon 3 kDa MWCO centrifugal filter (Merck Millipore). For the synthesis of ditopic A’-A’ CC ligand ...
-
bioRxiv - Biophysics 2022Quote: ... and were dissolved in a mixture of chloroform / methanol (7:3 vol/vol, both from Merck KGaA) to yield four stock solutions at 1.5 mM lipid concentration ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Microbiology 2023Quote: ... LB plates were seeded with the different cultures and Whatman n° 1 filter discs (6 mm) were impregnated with 5 μl of 30% (v/v) H2O2 (Merck) as previously described [31] ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Neuroscience 2022Quote: ... was combined with 90μM sygRNA (5’ - GGATTTGGTAATAGCAG AGGGGG 3’) (Merck) at RT for 15 minutes to form an RNP complex ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA oligonucleotide G4A4 (5’-AAAAAAGGGGAAAAGGGGAAAAGGGGAAAAGGGGAAAAAA-3’) was purchased from Merck. CD analysis of 2,5 µM RNA was carried out in the buffer used for G4-pulldown ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-HA-7 (Merck H9658; RRID:AB_260092; WB 1:20000) mouse anti-T7-tag (Merck 69522 ...
-
bioRxiv - Cell Biology 2020Quote: ... TE-7 (mouse, 1:200, Cat nb CBBL271, Merck, Sigma), Pax7 (mouse ...
-
bioRxiv - Cancer Biology 2023Quote: ... and DEHP (1 µM, CAS no. 117-81-7, Merck) and the other was exposed by drinking water to the vehicle (absolute ethanol diluted at 1/106 in water) ...
-
bioRxiv - Immunology 2023Quote: ... WT mice were 7-8 week-old Mice (C57BL/6 WT or Nr4a3-Timer-GS) were injected with 10 mg/kg azoxymethane (Merck) via i.p ...
-
bioRxiv - Cell Biology 2019Quote: ... cleared extracts were incubated 2h-6h at +4°C in an orbital shaker with anti-FLAG sepharose beads (M2 clone, Merck, A2220). Bound complexes were pelleted and 5x washed (Lysis buffer with 1M NaCl) ...
-
bioRxiv - Systems Biology 2020Quote: Wnt signal inhibitor (CK) stock (2.4–3 mM): CKI-7 dihydrochloride (#C0742-5MG, Merck & Co., Inc., NJ, USA) diluted in distilled water (Otsuka Pharmaceutical Factory ...
-
bioRxiv - Neuroscience 2020Quote: ... pH 7.4) (final concentration: 12mg/mL) containing 5 μL Benzonase (final concentration: 1 μL benzonase/mL (MERCK, 71205-3). After dissolving ...
-
bioRxiv - Neuroscience 2021Quote: ... 2′,7′-Dichlorofluorescin diacetate (DCFH-DA, Merck, Darmstadt, Germany, 1 mM) dissolved in PBS was added to each well and the plate was placed in the dark for 10 min at room temperature for cell uptake ...
-
bioRxiv - Microbiology 2022Quote: A CRISPR array containing 6 identical spacers targeting the tetR gene flanked by 7 repeats was cloned into pCDF-Duet (Novagen, Merck Millipore) by ligation after NcoI and SalI digestion ...
-
bioRxiv - Microbiology 2021Quote: ... and RSV-F (1:500 dilution, conjugated to a 488 fluorophore MAB8262X, Merck), incubating overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... polyethyleneimine cellulose-F plates (Merck) were previously pre-run with water ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and host plants was assessed by extracting the compounds following [6] by immersing the samples for 5 min in 5 ml of hexane (99%, SupraSolv, Merck, Germany), followed by removal from hexane with entomological tweezers that were previously cleaned with hexane ...
-
bioRxiv - Neuroscience 2019Quote: ... 3-octanol (OCT; 1:1000; Merck) and 4-methylcyclohexanol (MCH ...
-
bioRxiv - Developmental Biology 2019Quote: ... The cells were passaged per 3–5 days using Accutase (Merck-Millipore), mechanically scraped ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and 0.15% 3-[(3- Cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS, Merck Chemicals Ltd.). NADH:decylubiquinone (DQ) ...
-
bioRxiv - Cell Biology 2021Quote: 6 μL of 70 kDa FITC-dextran in EGM-2 (5 mg/mL, Merck, #46945) was added to each vessel ...
-
bioRxiv - Plant Biology 2020Quote: ... samples were resuspended in Urea 7 M and Thiourea 2 M buffer and desalted on Amicon Ultra-0.5 3 kDa centrifugal filters (Merck Millipore, Germany). Filters were filled to maximum capacity with buffers and centrifuged at 15,000 g for 10 min at 20°C ...