Labshake search
Citations for Merck :
1 - 50 of 4182 citations for 6 Methyl benzo 1 3 dioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 5(6)-Carboxyfluorescein (CF) (Merck; 100 mM CF stock ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Neuroscience 2024Quote: ... 1-methyl-D-tryptophan (1-DMT; 1-LMT enantiomer, both Merck Life Sciences) for exploration of a possible tryptophan mechanism of immunosuppression ...
-
bioRxiv - Immunology 2022Quote: ... approximately 5×105 Calu-3 cells were pre-treated with kp7-6 (100 ug/mL, CD95/CD95L antagonist, Merck) for 2 hour and then infected with SARS-CoV-2 at an MOI of 0.2 ...
-
bioRxiv - Immunology 2023Quote: ... Pepstatin A Methyl Ester (Pepstatin A, 516485) and MCC950 (256373-96-3) were purchased from Merck. Ultrapure™ DNase/RNase-Free Distilled Water (10977035 ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Microbiology 2023Quote: ... 1 filter disc (6 mm) impregnated with 5 µM of 30% (v/v) H2O2 (Merck) was placed on the seeded plate ...
-
bioRxiv - Microbiology 2020Quote: ... The internal standard was 1 μL of methyl heneicosanoate (10 mg/mL) and Bacterial acid methyl ester (BAME) mix (Merck-Millipore, Burlington, MA, USA) was used to identify the each peak of fatty acids and analytical standards for each fatty acid were used for quantification.
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Biochemistry 2019Quote: ... and csm5 were cloned into pACYCDuet-1 (5’-NcoI, 3’-XhoI; Novagen, Merck Millipore), csm4 was cloned into pEHisTEV (5’-NcoI ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Biochemistry 2023Quote: ... 400 μg of AtLEGβ or papain were inhibited with 0.5 mM or 5 mM S-methyl methanethiosulfonate (MMTS, Merck), respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Physiology 2020Quote: ... and embedded in methyl methacrylate (MMA; Merck). The received block was additionally referenced for further control with the milling of three opposing grooves.
-
bioRxiv - Genetics 2022Quote: ... 4 serial 10-fold dilutions of the viral stock were applied to each well of a 6-well mESC plate (MOCK plus 10−3 to 10−6) for transduction with 8 ng/μl polybrene (Merck). Two replicates were generated for each well ...
-
bioRxiv - Cancer Biology 2024Quote: ... Only treatment naive patients that underwent anti-PD-1 monotherapy with either pembrolizumab (200 mg IV every 3 weeks or 400 mg IV every 6 weeks, Merck) or nivolumab (240 mg IV every 2 weeks or 480 mg IV every 4 weeks ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.625 mM TBTA (Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine) (Merck Millipore), and 6.25 mM CuSO4 (Merck Millipore) ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 and 6 were pooled and concentrated to 1 ml using 10 kDa centrifugal filter (Amicon Ultra-2ml, Merck Millipore ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 mM K4Fe(CN)6 and 1 mg/ml X-gal (Roth)) and counterstained with nuclear fast red (Merck) for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... To each tube 1 μL of Tris((1-benzyl-4-triazolyl)methyl)amine (TBTA) solution (2.5 mM in DMSO; Merck), 10 μL of Tetrakis(acetonitrile)copper(I ...
-
bioRxiv - Neuroscience 2023Quote: ... and stained with 5 µM 4′,6-diamidino-2-phenylindole (DAPI) (Merck) in PBS if required ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 μM 6-benzylaminopurine (BAP; Merck Life Science UK Ltd., Gillingham, UK) (0.1% v/v Tween20) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Microbiology 2023Quote: ... LB plates were seeded with the different cultures and Whatman n° 1 filter discs (6 mm) were impregnated with 5 μl of 30% (v/v) H2O2 (Merck) as previously described [31] ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Neuroscience 2022Quote: ... was combined with 90μM sygRNA (5’ - GGATTTGGTAATAGCAG AGGGGG 3’) (Merck) at RT for 15 minutes to form an RNP complex ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA oligonucleotide G4A4 (5’-AAAAAAGGGGAAAAGGGGAAAAGGGGAAAAGGGGAAAAAA-3’) was purchased from Merck. CD analysis of 2,5 µM RNA was carried out in the buffer used for G4-pulldown ...
-
bioRxiv - Bioengineering 2019Quote: ... The supernatant was passed through the cartridges (pre-conditioned with 5 mL each of tert-methyl butyl ether, methanol (Merck; laboratory grade purity) and deionised water ...
-
bioRxiv - Neuroscience 2020Quote: ... pH 7.4) (final concentration: 12mg/mL) containing 5 μL Benzonase (final concentration: 1 μL benzonase/mL (MERCK, 71205-3). After dissolving ...
-
bioRxiv - Microbiology 2021Quote: ... Methyl viologen dichloride hydrate (paraquat, 98% purity) and Isopropil-β-D-1-tiogalactopiranósido (IPTG) were purchased from Merck.
-
bioRxiv - Biochemistry 2024Quote: ... Samples were derivatized for 1 hour at 85 °C using N-tert-Butyldimethylsilyl-N-methyl-trifluroacetamide with 1% tert-Butyldimethylchlorosilane (Merck, NJ, USA) and immediately analysed by GC-MS ...
-
bioRxiv - Plant Biology 2020Quote: DSF (cis-11-methyl-2-dodecenonic) was purchased from Merck and dissolved in DMSO to obtain 100 mM stock ...
-
bioRxiv - Biophysics 2022Quote: ... sucrose and methyl-β-cyclodextrin (mβCD) were obtained from Merck KGaA ...
-
bioRxiv - Developmental Biology 2023Quote: ... to which 10 µg/mL of methyl stearate (Merck, Singapore) was added as an internal standard ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and host plants was assessed by extracting the compounds following [6] by immersing the samples for 5 min in 5 ml of hexane (99%, SupraSolv, Merck, Germany), followed by removal from hexane with entomological tweezers that were previously cleaned with hexane ...
-
bioRxiv - Neuroscience 2019Quote: ... 3-octanol (OCT; 1:1000; Merck) and 4-methylcyclohexanol (MCH ...
-
bioRxiv - Developmental Biology 2019Quote: ... The cells were passaged per 3–5 days using Accutase (Merck-Millipore), mechanically scraped ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and 0.15% 3-[(3- Cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS, Merck Chemicals Ltd.). NADH:decylubiquinone (DQ) ...
-
bioRxiv - Cell Biology 2021Quote: 6 μL of 70 kDa FITC-dextran in EGM-2 (5 mg/mL, Merck, #46945) was added to each vessel ...
-
bioRxiv - Developmental Biology 2019Quote: ... The cells were blocked in 3% BSA (Applichem) and 5% donkey serum (Merck) in PBS for 2 hours at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... reverse: 5’-CCAGGGTGGAGCGGTC-3’) and the KOD Hot Start Mastermix (Merck, Darmstadt, Germany). The plasmids were confirmed by sequencing (Seqlab ...
-
bioRxiv - Biochemistry 2023Quote: ... PAPS (adenosine 3′-phosphate 5′-phosphosulfate, lithium salt hydrate) was purchased from Merck and stored at -80 °C to afford maximal stability.
-
bioRxiv - Neuroscience 2023Quote: ... The AAV titer was quantified using PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Cell Biology 2022Quote: IBMX (3-Isobutyl-1-Methylxanthin – 15879 - Merck) and lidocaine (L7757 – Merck ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-acetylated α-tubulin (clone 6-11B-1, Merck; ExM, 1:250), mouse anti-acetylated α-tubulin (T7451 ...
-
bioRxiv - Immunology 2021Quote: ... cells were treated with 66 µM Methyl-β-cyclodextrin (MβCD) (Merck, USA) for 1 hour ...