Labshake search
Citations for Merck :
1 - 50 of 2040 citations for 6 Isobutoxy 5 methylpyridine 3 boronic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... 5% acetic acid (Merck), and dried using SpeedVac (Eppendorf) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5% Trifluoroacetic acid (TFA, Merck), 1 M glycolic acid (Sigma) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5(6)-Carboxyfluorescein (CF) (Merck; 100 mM CF stock ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... 3-Indoleacetic acid (IAA, auxin) (Merck, I2886) and 1-Naphthaleneacetic acid (NAA ...
-
bioRxiv - Cell Biology 2022Quote: ... in 5% acetic acid (1.00063.1000; Merck). Membranes were blocked for 1 h at RT with 5% non-fat milk in PBS-T (1X PBS ...
-
bioRxiv - Microbiology 2023Quote: ... 5% formic acid (FA, Merck-Millipore) twice for 20 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... 32.8 mM 20:4 and 60 mM 22:6) and pipetted dropwise into N2 media containing 3 mM fatty acid-free BSA (Merck, Cat. #A8806) at 37°C with constant stirring to obtain final concentrations of 3 mM 18:0 ...
-
bioRxiv - Bioengineering 2021Quote: ... with 5 mM sulfuric acid (>99.5 %, Merck) as a mobile phase at 45 °C for ethanol ...
-
bioRxiv - Bioengineering 2020Quote: ... with 5 mM sulfuric acid (>99.5 %, Merck) as a mobile phase at 45 °C ...
-
bioRxiv - Immunology 2022Quote: ... approximately 5×105 Calu-3 cells were pre-treated with kp7-6 (100 ug/mL, CD95/CD95L antagonist, Merck) for 2 hour and then infected with SARS-CoV-2 at an MOI of 0.2 ...
-
bioRxiv - Cell Biology 2023Quote: ... the samples were incubated with Prussian’s blue solution containing ferrocyanide acid solutions (5% Hydrochloric acid (HCl) and 5% potassium ferrocyanide (Merck)) at a 1:1 ratio for 30 minutes ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Microbiology 2023Quote: ... Nucleic acids were labelled with 3 µM DAPI (Merck, Belgium) for 20 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... Tryptic peptides were successively extracted with 5 % formic acid (Merck)/50 % acetonitrile (Merck) ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2019Quote: All experiments were carried out in casamino acids medium (CAA) containing 5 gl-1 casamino acids (Merck, Switzerland), 1.18 g l−1 K2HPO4*3H2O ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Microbiology 2021Quote: ... was equilibrated with 5 mM sulphuric acid (H2SO4) (Titrisol, Merck, Germany) in water at 55 °C ...
-
bioRxiv - Genetics 2022Quote: ... 4 serial 10-fold dilutions of the viral stock were applied to each well of a 6-well mESC plate (MOCK plus 10−3 to 10−6) for transduction with 8 ng/μl polybrene (Merck). Two replicates were generated for each well ...
-
bioRxiv - Biophysics 2024Quote: ... The coated coverslips were rinsed twice with ethanol before incubation in 6% acetic acid (Merck) for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Plant Biology 2021Quote: ... (+/-)-Abscisic acid (ABA, CAS No:14375-45-2), and Gibberellic acid (GA3, CAS No: 77-06-5) were purchased from Merck KGaA/ Sigma-Aldrich (Darmstadt ...
-
bioRxiv - Bioengineering 2022Quote: ... which was stopped through acidification with 5 μl of trifluoroacetic acid (Merck). Fifteen μg of each resulting peptide mixture were then desalted on Stage Tip (Rappsilber et.al. ...
-
bioRxiv - Neuroscience 2023Quote: ... and stained with 5 µM 4′,6-diamidino-2-phenylindole (DAPI) (Merck) in PBS if required ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 μM 6-benzylaminopurine (BAP; Merck Life Science UK Ltd., Gillingham, UK) (0.1% v/v Tween20) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Neuroscience 2022Quote: ... was combined with 90μM sygRNA (5’ - GGATTTGGTAATAGCAG AGGGGG 3’) (Merck) at RT for 15 minutes to form an RNP complex ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA oligonucleotide G4A4 (5’-AAAAAAGGGGAAAAGGGGAAAAGGGGAAAAGGGGAAAAAA-3’) was purchased from Merck. CD analysis of 2,5 µM RNA was carried out in the buffer used for G4-pulldown ...
-
bioRxiv - Biophysics 2020Quote: ... Then His-tag containing OpuAC was introduced to the flow cell (in buffer B supplemented with 10 mM of (±)6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid (Trolox; Merck) as a photostabilizer[20] ...
-
bioRxiv - Biophysics 2019Quote: ... Measurements were done in buffer A supplemented with 1 mM 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox; Merck) and 10 mM Cysteamine (Merck).
-
bioRxiv - Pathology 2023Quote: ... the slides were washed with acidified water (5 mL glacial acetic acid (Merck) in 11 mL distilled water ...
-
bioRxiv - Cell Biology 2023Quote: ... beta-galactosidase solution was prepared containing 20 mM citric acid (pH=6) (ref 1.00244.0500, Merck Millipore, Darmstadt, Germany), 5 mM of potassium hexacyano-ferrate (II ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting peptides were extracted in 70% ethanol plus 5% formic acid (Merck-Millipore) twice for 20 min with permanent shaking ...
-
bioRxiv - Plant Biology 2022Quote: ... a 70% ethanol solution containing 100 mM indole-3-acetic acid (IAA) (Merck KGaA, Darmstadt, Germany) was diluted 10,000 times in water to reach a final concentration of 10 μM IAA ...
-
bioRxiv - Biochemistry 2020Quote: ... Prepared solutions were mixed at 3:1 ratio with 20% α-cyano-4-hydroxycinnamic acid (Merck) solution in 20% ACN ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... in absolute ethanol (Thermo-Fischer; order code AJA214-2.5LPL) and 3 mL of propionic acid (Merck, Pty Ltd. ...
-
bioRxiv - Molecular Biology 2019Quote: To evaluate microscopic features of the captured cells such as morphological types and possible alterations we then used another collection membrane directly stained with hematoxylin and eosin after fixation for 10 min in a fixation solution (100 mL of 70% ethanol, 5 mL of glacial acetic acid and 5 mL of 37% formaldehyde solution – all solutions are from Merck Millipore). Samples were hydrated with distilled water for 5 minutes ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and host plants was assessed by extracting the compounds following [6] by immersing the samples for 5 min in 5 ml of hexane (99%, SupraSolv, Merck, Germany), followed by removal from hexane with entomological tweezers that were previously cleaned with hexane ...
-
bioRxiv - Developmental Biology 2019Quote: ... The cells were passaged per 3–5 days using Accutase (Merck-Millipore), mechanically scraped ...
-
bioRxiv - Plant Biology 2020Quote: Inflorescences were harvested into fresh fixative (3:1 96% [v/v] ethanol [Merck] and glacial acetic acid) and kept overnight (O/N ...
-
bioRxiv - Cancer Biology 2022Quote: ... and functionalized by 200 µl of a 3% (v/v) solution of hyaluronic acid (HA) (Merck, Germany) at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... cells were fixed and permeabilized with a 3:1 mixture of methanol (Klinipath)-glacial acetic acid (Merck) for 10 min ...
-
bioRxiv - Cell Biology 2021Quote: 6 μL of 70 kDa FITC-dextran in EGM-2 (5 mg/mL, Merck, #46945) was added to each vessel ...
-
bioRxiv - Microbiology 2023Quote: ... 1 filter disc (6 mm) impregnated with 5 µM of 30% (v/v) H2O2 (Merck) was placed on the seeded plate ...