Labshake search
Citations for Merck :
1 - 50 of 2421 citations for 6 Chloro 5 fluoro 1H indole 2 3 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... and CldU 100 μM (5-chloro-2’-deoxyuridine, C6891, MERCK). Cells were embedded in agarose block and DNA was prepared and combed on silanized coverslips ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
bioRxiv - Microbiology 2022Quote: ... 2-heptyl-3- hydroxy-4(1H)-quinolone (PQS) (Sigma Aldrich, Merck Life Science ...
-
bioRxiv - Molecular Biology 2023Quote: ... exponentially growing RPE-1 cells were pulse-labeled with 1 μM CldU (5-Chloro-2’-deoxyuridine, Merck, C6891) and 250 μM IdU (5-Iodo-2’-deoxyuridine ...
-
bioRxiv - Neuroscience 2022Quote: ... They were recorded in the presence of 10 mM CNQX (6-cyano-7-nitroquinoxaline-2,3-dione, Merck) and 50 mM D-AP5 (D-2-amino-5-phosphonovalerate ...
-
bioRxiv - Developmental Biology 2024Quote: ... for 1h and 2% glacial acetic acid (Merck) for 1h ...
-
bioRxiv - Plant Biology 2022Quote: ... a 70% ethanol solution containing 100 mM indole-3-acetic acid (IAA) (Merck KGaA, Darmstadt, Germany) was diluted 10,000 times in water to reach a final concentration of 10 μM IAA ...
-
bioRxiv - Neuroscience 2023Quote: ... and stained with 5 µM 4′,6-diamidino-2-phenylindole (DAPI) (Merck) in PBS if required ...
-
bioRxiv - Molecular Biology 2021Quote: ... 200 ng/ml NT3 (Alomone labs) and 20 μM 5-Fluoro-21-deoxyuridine (FdU; Merck). Cells were maintained in 37°C ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Molecular Biology 2020Quote: ... and motile indole lysine (MIL) decarboxylase (Merck, Germany). Salmonella positive samples were recorded ...
-
bioRxiv - Biochemistry 2023Quote: ... 5(6)-Carboxyfluorescein (CF) (Merck; 100 mM CF stock ...
-
bioRxiv - Cell Biology 2021Quote: 6 μL of 70 kDa FITC-dextran in EGM-2 (5 mg/mL, Merck, #46945) was added to each vessel ...
-
bioRxiv - Biochemistry 2024Quote: ... a volume of 1H,1H,2H,2H-perfluoro-1-octanol (PFO, Merck) is added to the emulsion with gentle pipetting used to break the emulsion ...
-
bioRxiv - Microbiology 2022Quote: ... 4-chloro-7-nitrobenzofurazan (NBD-Cl; Merck, 98%), 1-iodododecane (Merck ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 20 μl, 5 mg/ml, Merck) was added to each well ...
-
bioRxiv - Immunology 2022Quote: ... approximately 5×105 Calu-3 cells were pre-treated with kp7-6 (100 ug/mL, CD95/CD95L antagonist, Merck) for 2 hour and then infected with SARS-CoV-2 at an MOI of 0.2 ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Plant Biology 2024Quote: ... 2-(1H-Indol-3-yl)-4-oxo-4-phenyl-butyric acid (PEO-IAA; OlChemIm, Olomouc, Czech Republic) and indole-3-carbinol (I3C; Sigma-Aldrich, Merck KGaA, Darmstadt, Germany).
-
bioRxiv - Systems Biology 2022Quote: ... 2 x 3’ Neoclear (Merck), 2 x 3 ‘ 100% ETOH ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Biophysics 2021Quote: ... Fusion was induced by surfactant replacement with 1H,1H,2H,2H-Perfluoro-1-octanol (Merck) (PFO) ...
-
bioRxiv - Bioengineering 2024Quote: ... the emulsion was destabilized by adding the surfactant 1H,1H,2H,2H-Perfluoro-1-octanol (Merck) on top of the buffer ...
-
bioRxiv - Immunology 2021Quote: ... either 4′,6-Diamidine-2′-phenylindole dihydrochloride (Merck) or LIVE/DEAD™ Fixable Near-IR stain kit (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... 4′,6-Diamidine-2′-phenylindole dihydrochloride (10236276001, Merck); Dox-NP (300112 ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... the channels where coated/treated with 1% (v/v) Trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Merck) in HFE-7500 (Fluorochem ...
-
bioRxiv - Bioengineering 2021Quote: ... The master was passivated by vapor deposition of perfluorosilane (1H,1H,2H,2H-perfluorooctyl-trichlorosilane, Merck kGaA). Specifically ...
-
bioRxiv - Cell Biology 2023Quote: ... Silanization was performed by applying two drops of Trichloro (1H,1H,2H,2H-perfluorooctyl) silane (Merck, 44893) onto a sheet of aluminium foil ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were mounted in CitiFluor™ CFM3 mounting medium (proSciTech, Australia) containing 3 μg/uL 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Merck, Germany) to stain nucleic acids ...
-
bioRxiv - Developmental Biology 2020Quote: ... The gels were subsequently demulsified with 45 µl 1H,1H,2H,2H Perfluoro 1 octanol (PFO) (Merck, #370533) into 200μl of MM+ Ri medium ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4′,6-diamidino-2-phenylindole (DAPI; Merck Life Science) 0.1 µg/mL was added to the medium to exclude dead cells.
-
bioRxiv - Cell Biology 2023Quote: ... 4’,6-diamidine-2’-phenylindole dihydrochloride (DAPI) (Merck #10236276001) at a final concentration of 1 µg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Cell Biology 2021Quote: ... Surfaces were functionalised by flooding the device with 1% (v/v) trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Merck) in HFE-7500™ (3M™) ...
-
bioRxiv - Biochemistry 2024Quote: ... Diener Electronic) followed by channel surface functionalization using 1% (v/v) trichloro(1H,1H,2H,2H-perfluorooctyl) silane (Merck) in HFE-7500™ (3M™ Novec™).
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Microbiology 2023Quote: ... Hydrophobic surface treatment was performed after bonding by flushing with 1% (v/v) trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Merck) in HFE-7500 and ...
-
bioRxiv - Genetics 2022Quote: ... 4 serial 10-fold dilutions of the viral stock were applied to each well of a 6-well mESC plate (MOCK plus 10−3 to 10−6) for transduction with 8 ng/μl polybrene (Merck). Two replicates were generated for each well ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI, #10236276001, Merck) staining ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Staining cryosections with 4’,6-diamidino-2-phenylindole (DAPI, Merck) and active caspase-3 ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Biochemistry 2022Quote: The matrix 2′,5′-dihydroxyacetophenone (DHAP; Merck) was applied by sublimation and the data were acquired on a modified timsTOF fleX instrument (Bruker Daltonics ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4 °C overnight on a rolling mixer (30 r.p.m.) ...
-
Epicardial slices: a 3D organotypic model for the study of epicardial activation and differentiationbioRxiv - Bioengineering 2020Quote: ... and nuclei staining with DAPI (4′,6-diamidino-2-phenylindole, Merck) for 10 minutes at RT ...
-
bioRxiv - Bioengineering 2022Quote: ... Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole, Merck) for 10 minutes at room temperature ...