Labshake search
Citations for Merck :
1 - 50 of 4769 citations for 6 4 Methoxy phenyl 3 phenyl pyrazolo 1 5 a pyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Plant Biology 2024Quote: ... 2-(1H-Indol-3-yl)-4-oxo-4-phenyl-butyric acid (PEO-IAA; OlChemIm, Olomouc, Czech Republic) and indole-3-carbinol (I3C; Sigma-Aldrich, Merck KGaA, Darmstadt, Germany).
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 200µM of 1-phenyl-2-thiourea (PTU, ref. n°P7629, Merck/Sigma-Aldrich) to avoid pigmentation ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 0.43 mM MgCl2) with the addition of 0.2 mM 1-phenyl-2-thiourea (PTU, Merck, Germany) to block pigmentation ...
-
bioRxiv - Neuroscience 2023Quote: ... and stained with 5 µM 4′,6-diamidino-2-phenylindole (DAPI) (Merck) in PBS if required ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4 °C overnight on a rolling mixer (30 r.p.m.) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
bioRxiv - Biochemistry 2023Quote: ... 5(6)-Carboxyfluorescein (CF) (Merck; 100 mM CF stock ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Molecular Biology 2019Quote: ... from an 18500g centrifugation (6 min at +4°C) were run through 3-kDa cut-off centrifugal filters (Amicon Ultra-0.5 ml, Merck) into pre-weighted collection tubes to remove remaining macromolecules ...
-
bioRxiv - Cancer Biology 2024Quote: ... counterstained with 5µg of 4’,6-diamidino-2-phenylindole (DAPI – 1:1) (Sigma/Merck, D9542-10mg) to eliminate dead cells before running through the flow cytometer ...
-
bioRxiv - Immunology 2019Quote: ... the inhibitor 6-amino-4–4-phenoxyphenylethylamino-quinazoline (Merck Millipore, USA) was reconstituted in DMSO at a stock concentration of 1mM and administered at a final concentration of 10nM on Days 0 and 4 ...
-
bioRxiv - Immunology 2022Quote: ... approximately 5×105 Calu-3 cells were pre-treated with kp7-6 (100 ug/mL, CD95/CD95L antagonist, Merck) for 2 hour and then infected with SARS-CoV-2 at an MOI of 0.2 ...
-
bioRxiv - Immunology 2021Quote: ... either 4′,6-Diamidine-2′-phenylindole dihydrochloride (Merck) or LIVE/DEAD™ Fixable Near-IR stain kit (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... 4′,6-Diamidine-2′-phenylindole dihydrochloride (10236276001, Merck); Dox-NP (300112 ...
-
Highly amine-reactive graphene-oxide EM grids for biochemical surface modification in aqueous bufferbioRxiv - Molecular Biology 2023Quote: ... 4-Amino-1-butanol (#178330) and 3- glycidoxypropyltrimethoxysilane (#440167) were obtained from Merck. Gold nanoparticle- PEG-amine conjugate was custom-synthesized by NanoPartz (Loveland CO ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: When the tumor sizes reached to 80 mm3 animals were treated with a PFKFB3 inhibitor 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one) (3PO) (Sigma-Aldrich, Merck, Overijse, Belgium). The animals received intraperitoneal (i.p. ...
-
bioRxiv - Microbiology 2023Quote: ... 1 filter disc (6 mm) impregnated with 5 µM of 30% (v/v) H2O2 (Merck) was placed on the seeded plate ...
-
bioRxiv - Developmental Biology 2022Quote: ... 32.8 mM 20:4 and 60 mM 22:6) and pipetted dropwise into N2 media containing 3 mM fatty acid-free BSA (Merck, Cat. #A8806) at 37°C with constant stirring to obtain final concentrations of 3 mM 18:0 ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were mounted in CitiFluor™ CFM3 mounting medium (proSciTech, Australia) containing 3 μg/uL 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Merck, Germany) to stain nucleic acids ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4′,6-diamidino-2-phenylindole (DAPI; Merck Life Science) 0.1 µg/mL was added to the medium to exclude dead cells.
-
bioRxiv - Cell Biology 2023Quote: ... 4’,6-diamidine-2’-phenylindole dihydrochloride (DAPI) (Merck #10236276001) at a final concentration of 1 µg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... cells nuclei were stained with DAPI (4′,6-diamidino-2-fenilindol, 1:10000, Merck, cat#D9542) for 5 minutes at RT and mounted in Lab Vision™ PermaFluor™ Aqueous Mounting Medium (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then incubated with 4’,6-diamidino-2-phenylindole (DAPI; 1:10,000; Merck Millipore) and mounted on slides with Mowiol (Merck Millipore ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... 4-amino pyridine (5 mM, Merck) and TTX (0.5-1 μM ...
-
bioRxiv - Biochemistry 2019Quote: ... and csm5 were cloned into pACYCDuet-1 (5’-NcoI, 3’-XhoI; Novagen, Merck Millipore), csm4 was cloned into pEHisTEV (5’-NcoI ...
-
bioRxiv - Developmental Biology 2023Quote: ... gastruloids were incubated with secondary antibodies and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4°C overnight ...
-
bioRxiv - Neuroscience 2023Quote: For conditioning the odors 4-MCH (1:250, Merck, Darmstadt, Germany,CAS #589-91-3) and 3-OCT (1:167 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI, #10236276001, Merck) staining ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Staining cryosections with 4’,6-diamidino-2-phenylindole (DAPI, Merck) and active caspase-3 ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Physiology 2024Quote: ... Calcium chloride dihydrate (CaCl2.2H2O) used for cross-linking low methoxy pectin was procured from Merck Specialities Private Limited ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...
-
bioRxiv - Biochemistry 2020Quote: ... Prepared solutions were mixed at 3:1 ratio with 20% α-cyano-4-hydroxycinnamic acid (Merck) solution in 20% ACN ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
Epicardial slices: a 3D organotypic model for the study of epicardial activation and differentiationbioRxiv - Bioengineering 2020Quote: ... and nuclei staining with DAPI (4′,6-diamidino-2-phenylindole, Merck) for 10 minutes at RT ...
-
bioRxiv - Bioengineering 2022Quote: ... Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole, Merck) for 10 minutes at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... Sections were incubated with DAPI (4′,6-diamidino-2-phenylindole, Merck) for 20 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Cell Biology 2023Quote: ... The blots were developed in a solution of nitroblue tetrazolium chloride (NBT) and 5-brom-4-chlor-3-indoxylphosphate (BCIP; Merck, Darmstadt, Germany) for 5–30 min at RT ...
-
bioRxiv - Genetics 2022Quote: ... 4 serial 10-fold dilutions of the viral stock were applied to each well of a 6-well mESC plate (MOCK plus 10−3 to 10−6) for transduction with 8 ng/μl polybrene (Merck). Two replicates were generated for each well ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were stained with DAPI before mounting with Mowiol (12 mL of 0.2 M Tris buffer pH8.5, 6 mL distilled water, 6 g glycerol, 2.4 g Mowiol 4-88, Merck Millipore).
-
bioRxiv - Neuroscience 2023Quote: ... Coverslips were shortly rinsed in distilled water and mounted using Mowiöl (12 ml of 0.2 M Tris buffer, 6 ml distilled water, 6 g glycerol, 2.4 g Mowiol 4-88, Merck Millipore). Samples were imaged directly or within the next 48h ...