Labshake search
Citations for Merck :
1 - 50 of 2293 citations for 5 Methyl 3 phenylmethylene 2 3H furanone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: DSF (cis-11-methyl-2-dodecenonic) was purchased from Merck and dissolved in DMSO to obtain 100 mM stock ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 20 μl, 5 mg/ml, Merck) was added to each well ...
-
bioRxiv - Immunology 2023Quote: ... Pepstatin A Methyl Ester (Pepstatin A, 516485) and MCC950 (256373-96-3) were purchased from Merck. Ultrapure™ DNase/RNase-Free Distilled Water (10977035 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ACV(9-[(2-Hydroxyethoxy)methyl]guanine) was obtained as a gift sample from Merck, India ...
-
bioRxiv - Biochemistry 2020Quote: ... MO) and 3H-Ezetimibe was from Merck. EZ-link Sulfo-NHS-SS-Biotin ...
-
bioRxiv - Neuroscience 2022Quote: [3H]gaboxadol (a gift from Merck, Inc.) was used with modified protocols from Dr ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 x 3’ Neoclear (Merck), 2 x 3 ‘ 100% ETOH ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were incubated for 72h with the indicated concentrations of the respective drugs and further incubated for 3h with 5 mg/ml MTT (Merck). Finally ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Biochemistry 2023Quote: ... 400 μg of AtLEGβ or papain were inhibited with 0.5 mM or 5 mM S-methyl methanethiosulfonate (MMTS, Merck), respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Physiology 2020Quote: ... and embedded in methyl methacrylate (MMA; Merck). The received block was additionally referenced for further control with the milling of three opposing grooves.
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Biochemistry 2022Quote: The matrix 2′,5′-dihydroxyacetophenone (DHAP; Merck) was applied by sublimation and the data were acquired on a modified timsTOF fleX instrument (Bruker Daltonics ...
-
bioRxiv - Molecular Biology 2024Quote: ... fixed with 2% paraformaldehyde (PFA) in PHEM and washed once for 5 min at (RT) with 3% BSA (bovine serum albumin, Merck-Sigma, Germany) in Tris-buffered saline with 10 mM EGTA and 2 mM MgCl2 (TBSTEM) ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 × 3 min Neo-Clear (Cat. No. 1.09843, Merck), 2 × 3 min 100% ethanol ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Neuroscience 2022Quote: ... was combined with 90μM sygRNA (5’ - GGATTTGGTAATAGCAG AGGGGG 3’) (Merck) at RT for 15 minutes to form an RNP complex ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA oligonucleotide G4A4 (5’-AAAAAAGGGGAAAAGGGGAAAAGGGGAAAAGGGGAAAAAA-3’) was purchased from Merck. CD analysis of 2,5 µM RNA was carried out in the buffer used for G4-pulldown ...
-
bioRxiv - Bioengineering 2019Quote: ... The supernatant was passed through the cartridges (pre-conditioned with 5 mL each of tert-methyl butyl ether, methanol (Merck; laboratory grade purity) and deionised water ...
-
bioRxiv - Plant Biology 2021Quote: ... and half-strength phosphatase inhibitor cocktail 2 and 3 (Merck). Samples were clarified twice by centrifugation at 14 000 g ...
-
bioRxiv - Cell Biology 2023Quote: ... in 2× saline sodium citrate (SSC; Merck, 6132-04-3)) for 5 min at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... The internal standard was 1 μL of methyl heneicosanoate (10 mg/mL) and Bacterial acid methyl ester (BAME) mix (Merck-Millipore, Burlington, MA, USA) was used to identify the each peak of fatty acids and analytical standards for each fatty acid were used for quantification.
-
bioRxiv - Biophysics 2022Quote: ... sucrose and methyl-β-cyclodextrin (mβCD) were obtained from Merck KGaA ...
-
bioRxiv - Developmental Biology 2023Quote: ... to which 10 µg/mL of methyl stearate (Merck, Singapore) was added as an internal standard ...
-
bioRxiv - Microbiology 2022Quote: ... 2-heptyl-3- hydroxy-4(1H)-quinolone (PQS) (Sigma Aldrich, Merck Life Science ...
-
bioRxiv - Developmental Biology 2019Quote: ... The cells were passaged per 3–5 days using Accutase (Merck-Millipore), mechanically scraped ...
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Developmental Biology 2022Quote: ... HUVEC were treated with 500nM 5-Aza-2’-deoxycytidine (MERCK) dissolved in 0.9% NaCl ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-alpha tubulin (Merck-SIGMA, clone B-5-1-2) was used as a loading control at 1:10000.
-
bioRxiv - Molecular Biology 2023Quote: ... and 250 μM IdU (5-Iodo-2’-deoxyuridine, Merck, I7125) as described in the text ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti-α-Tubulin (B-5-1-2, Merck Millipore/Sigma) antibodies were purchased ...
-
bioRxiv - Genetics 2023Quote: ... and CldU 100 μM (5-chloro-2’-deoxyuridine, C6891, MERCK). Cells were embedded in agarose block and DNA was prepared and combed on silanized coverslips ...
-
bioRxiv - Developmental Biology 2019Quote: ... The cells were blocked in 3% BSA (Applichem) and 5% donkey serum (Merck) in PBS for 2 hours at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... reverse: 5’-CCAGGGTGGAGCGGTC-3’) and the KOD Hot Start Mastermix (Merck, Darmstadt, Germany). The plasmids were confirmed by sequencing (Seqlab ...
-
bioRxiv - Biochemistry 2023Quote: ... PAPS (adenosine 3′-phosphate 5′-phosphosulfate, lithium salt hydrate) was purchased from Merck and stored at -80 °C to afford maximal stability.
-
bioRxiv - Neuroscience 2023Quote: ... The AAV titer was quantified using PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Immunology 2021Quote: ... cells were treated with 66 µM Methyl-β-cyclodextrin (MβCD) (Merck, USA) for 1 hour ...
-
bioRxiv - Cell Biology 2021Quote: ... SV40 T Antigen (Ab-2) (Merck Millipore; DP02; 5 μg/ml). Secondary antibodies (all from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... Treatment with 2 µM hydrogen peroxide for 5 min (H2O2; Merck) was used to induce DNA strand-breaks and oxidative damage ...
-
bioRxiv - Genetics 2022Quote: ... 90 μl 5 M NaCl and 2 μl Pellet Paint (Merck) was added to each sample ...