Labshake search
Citations for Merck :
201 - 250 of 1007 citations for Galectin 3 LGALS3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Human plasma full- length fibronectin (FC010, Merck Darmstadt, Germany) was then applied to the dish at a concentration of 10 μg/μl for an incubation period of 1 hour at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Neuroscience 2019Quote: Plasma levels of adiponectin and leptin were measured using commercially available kits (Human Leptin Enzyme Immunoassay, Merck, Cat. #A05174 and Human Adiponectin ELISA, Merck, Cat. # EZHADP-61K). The minimum detectable dose of leptin was 7.8 pg/mL and that of adiponectin was 0.891 μg/mL.
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Molecular Biology 2024Quote: ... The embryos were then incubated with anti-cleaved caspase 3 pAb (1:100) (Anti-caspase-3, cleaved (Ab-2) Rabbit pAB (PC679; Merck) followed by a wash and a second incubation with anti-rabbit 568 ...
-
bioRxiv - Biochemistry 2023Quote: ... The 100-fold dilution of culture was made up to 10-4 dilutions and spotted on TYE plates (Hi-Media Laboratories Ltd., India) having 1% glucose (Merck & Co., USA) and ampicillin (Gold Biotechnology ...
-
bioRxiv - Immunology 2023Quote: ... Lysate was clarified by spinning cells for 10 min at 20,000 × g before loading supernatant onto cOmplete™ His-Tag purification resin (Merck; cat # 5893682001). Bound proteins were washed with 20 mM tris (pH 8.0) ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...
-
bioRxiv - Developmental Biology 2024Quote: ... passed through 3 drops of Advanced KSOM (Merck) and kept for 30 minutes in a drop of KSOM (Merck ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of Benzonase (Merck Millipore, US170664-3) was added and samples left on ice until an aqueous solution formed (30 min to 1 h) ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (BSA, Merck/Sigma-Aldrich) in PBS was added as blocking buffer and incubated for 1 hour ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3-NT (1:1000, 06-284, Merck) were used ...
-
bioRxiv - Neuroscience 2024Quote: ... or 3-NT (1:1000; 06-284, Merck). Following primary antibody incubation ...
-
bioRxiv - Immunology 2021Quote: ... Human pancreatic beta cell line 1.4E7 was purchased from Merck and cultured in RPMI-1640 medium (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... Part B was made of 10U/mL human thrombin (Merck) in DMEM/F12 ...
-
bioRxiv - Genetics 2020Quote: ... then rhCG (recombinant human chorionic gonadotropin alpha, OVIDREL, Merck Serono) on day 9 Oocytes were collected by laparoscopic follicular aspiration 32–35 h after rhCG administration ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and purified human C3a was purchased from Merck (Perth, Australia). Recombinant human C5a (rhC5a ...
-
bioRxiv - Immunology 2020Quote: ... and recombinant human RAP (Merck Millipore, 200 nM final concentration) were used to stimulate nuclear translocation of MerTK.
-
bioRxiv - Immunology 2020Quote: ... FITC conjugated goat anti-human IgG Fc was from Merck, Dorset ...
-
bioRxiv - Biophysics 2022Quote: Lyophilized recombinant human Chorionic Gonadotropin (hCG) (Chorulon Merck #140-927) is reconstituted with the included sterile 1x PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... coated with 50 µg/ml human serum fibronectin (Merck, Germany). Imaging was performed on a Nikon Widefield Ti2 equipped with a sCMOS ...
-
bioRxiv - Cell Biology 2023Quote: ... of the following ECM proteins: recombinant human fibronectin (Merck, 341631), recombinant human vitronectin (PeproTech ...
-
bioRxiv - Microbiology 2023Quote: ... sensitivity assays against human serum (Merck Millipore, Burlington, MA, USA), colistin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... Treatments used recombinant human TNFα (10 ng/ml; Merck 654245) and/or LMB (20 ng/ml ...
-
bioRxiv - Bioengineering 2023Quote: ... The human cardiomyocyte cell line AC16 was purchased from Merck Millipore (Burlington ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... and HRP-conjugated goat anti-human IgG (AP309P, Merck KGaA). Protein detection was done with enhanced chemiluminescence (ECL ...
-
bioRxiv - Genomics 2023Quote: ... After incubation with FcBlock (PBS + 12% human serum AB (Merck)) for 10 min at 4°C ...
-
bioRxiv - Bioengineering 2024Quote: Human fibrinogen from non-diseased donors (Merck Millipore, #341576-1GM) was reconstituted in sterile 0.9% saline to a stock concentration of 67mg/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... human MISSION esiRNA kntc2 (NDC80) (oligo #2, EHU042171-20UG, Merck), human ON-TARGETplus SMART pool NUF2 siRNA (L-005289-00-000 ...
-
bioRxiv - Neuroscience 2024Quote: ... and human plasmatic butyrylcholinesterase (hBChE, E.C. 3.1.1.8, purchased from Merck) were determined using the modified Ellman’s method ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Microbiology 2023Quote: ... The remaining 32P-γ-ATP was removed by washing with 3 column volumes of Millipore water and centrifugation in 10 kDa (Qβ-RNA) or 3 kDa (8mer) Amicon filters (Merck Millipore) at 14,000 rpm at 4 °C for four times ...