Labshake search
Citations for Merck :
1451 - 1500 of 5053 citations for 8 chloro 10 3 dimethylamino propyl phenothiazin 1 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2021Quote: ... 100 μL aliquots were removed and the reaction was stopped using a 3 KDa nominal molecular weight limit (NMWL) centrifuge filter (Merck Amicon Ultra 0.5mL Centrifugal Filters ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Major peaks were desalted by RP-HPLC using an Ascentis C18 column (3 μm, 4.6mm ID x 15 cm, Sigma-Merck, Germany) using peak-based collection (slope) ...
-
bioRxiv - Systems Biology 2020Quote: ... The resultant pellets were resuspended in 3% acetonitrile + 0.1% trifluoroacetic acid and peptide quantification performed using the Direct Detect system (Merck Millipore). Protein samples were normalized then vacuum concentrated in preparation for mass spectrometry.
-
bioRxiv - Cell Biology 2020Quote: ... Cell medium was replaced with 3 mL medium containing 20 μL of the purified lentivirus and 3μl polybrene transfection reagent (Merck Millipore). Medium was supplemented with 10 µg/mL puromycin for selection of successfully transduced cells two to three days after transduction.
-
bioRxiv - Biochemistry 2022Quote: ... The purified proteins were concentrated to 2 mg/mL using centrifugal filters with either 3 kDa or 30 kDa cut-off (Amicon Ultra-0.5, Merck/Millipore) and the samples were centrifuged at 100,000 g ...
-
bioRxiv - Cell Biology 2022Quote: ... The remaining media was then concentrated down to 500 uL using a falcon tube sized 3 kDa amicon column (UFC900308; Merck) spun at 4000 xg and 4°C for approximately 1 h ...
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Bioengineering 2022Quote: ... 100 nM of RNA polyhedra samples folded in TE/Mg2+/Na+ buffer were concentrated four times using 3 kDa MWCO Amicon Ultra centrifugal filters (Merck). 5 µl of the concentrated sample was applied on 300 mesh Cu grids coated with lacey carbon (Agar Scientific) ...
-
bioRxiv - Biochemistry 2022Quote: ... Chromatography was performed on a zwitterionic (ZIC) column with phosphocholine phase (ZIC-cHILIC, 2.1 mm i.d. x 150 mm, 3 μm; Merck SeQuant, Sweden) [38] ...
-
bioRxiv - Genetics 2021Quote: ... At day 10 cells were passaged at a 2:3 ratio into 12 well cell culture plates coated with 15 µg/ml human plasma fibronectin (Merck) in Dulbecco’s phosphate-buffered saline (DPBS ...
-
bioRxiv - Biophysics 2020Quote: ... The Q column flow-through containing nsp8 or nsp7 was concentrated using a MWCO 3 kDa Amicon Ultra Centrifugal Filter (Merck) and applied to a HiLoad S200 16/600 pg equilibrated in size exclusion buffer (150 mM NaCl ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The five eluted aliquots were then concentrated using an ultrafiltration device with a 3 kDa cut-off membrane (Amicon Ultra-0.5 Centrifugal Filter Unit; Merck, UK) and desalted with filtered water to remove urea and salts ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... ssDNA was eluted and concentrated using an ultrafiltration device with a 3 kDa cut-off membrane (Amicon Ultra-0.5 Centrifugal Filter Unit; Merck, UK), as described earlier ...
-
bioRxiv - Biophysics 2022Quote: ... Annealed samples were exchanged to NMR buffer (20 mM potassium phosphate, pH 7.0) using 3 kDa centrifugal filters (Amicon, Merck Inc.) spun at 4000 g and 4 °C to a final volume of 250 µL ...
-
bioRxiv - Bioengineering 2019Quote: ... Tween 20 with 3 % (w/v) skim milk powder and successively incubated with monoclonal mouse anti-T7 RNA polymerase antibodies (Novagen, Merck) and POD labelled goat anti-mouse antibodies (Sigma) ...
-
bioRxiv - Neuroscience 2019Quote: ... The HiTrap SP elution fractions containing the tau proteins were concentrated using a 30 MWCO or 3 MWCO Amicon centrifugal filter unit (Merck) and loaded on a HiLoad 16/600 Superdex 75 pg size exclusion chromatography column (GE Healthcare ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3 μg proteins were separated by SDS-PAGE and electrotransferred onto Immobilon®-P transfer membranes (Merck Millipore, MA, USA), blocked with 5% skim milk in Tris-buffered saline with 5% Tween 20 (TBST) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The purest and most concentrated fractions were then dialyzed by employing a 3 kDa membrane D-Tube Dialyzer (Merck, Germany) in PBS buffer (200 mM NaCl ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Chromatographic separation was carried out on an Agilent 1200 series quaternary HPLC system using a Chromolith Performance RP18-e column (100×3 mm) from Merck operated a temperature of 45°C with 1 mM ammonium formate in water containing 0.1% FA as mobile phase A and 1 mM ammonium formate in 95/5 (vol/vol ...
-
bioRxiv - Biochemistry 2019Quote: ... desalted pG was concentrated to a final concentration of 50 µM using Amicon 3 kDa MWCO centrifugal filters (Merck Millipore). 10 nmol lyophilized SMCC-functionalized ODN was reconstituted in 40 µL 50 µM pG (2 nmol ...
-
bioRxiv - Biochemistry 2021Quote: ... adjusted to pH 5.8 using 3 M HCl and filtered with 0.2 μm nylon membrane filters (GNWP04700, 0.2 μm pore size, Merck Millipore Ltd.), while mobile phase B consisted of 100% methanol ...
-
bioRxiv - Biochemistry 2021Quote: ... adjusted to pH 8 using 3 M HCl and filtered with 0.2 μm nylon membrane filters (GNWP04700, 0.2 μm pore size, Merck Millipore Ltd.), while mobile phase B consisted of 100% methanol (method described in Table 2) ...
-
bioRxiv - Immunology 2021Quote: ... 300 µL of saliva sample was mixed with 200 µL of 100 mM Tris-HCl buffer (pH 8.5; Nippon Gene Co., Ltd.) in an Amicon Ultra-0.5 Centrifugal Filter Unit (3 kDa; Merck Millipore Ltd), and the mixture was spun down at 14,000 g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... microglia were isolated and cultured for 3 days as above before cells were lysed in RIPA buffer (60 μL/well, Merck). Next ...
-
bioRxiv - Bioengineering 2022Quote: ... the wells were rinsed 3 times with PBS and covered with 100 μL 0.5% (v/v) Triton-X 100 (Merck, 1.08603.1000) in PBS for 5 minutes to permeabilize cells ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were reseeded and enriched by selection in their respective media with an added 2.5 µg/ml of puromycin for B16-F1 and 3 µg/ml of puromycin (Merck # p9620) for Rat2 cells ...
-
bioRxiv - Neuroscience 2022Quote: ... slide-mounted OE sections or free-floating OB slices were washed with PBS and incubated in 3 % BSA (Merck, A2153) with 0.25 % triton and 0.02 % sodium azide (Severn Biotech Ltd ...
-
bioRxiv - Microbiology 2022Quote: ... Parasitemias were calculated from day 3 post-infection by counting infected red blood cells in blood smears stained with Hemacolor (Merck).
-
bioRxiv - Immunology 2022Quote: ... the animal hemi-heads were fixed for 3 days at room temperature in 4% paraformaldehyde (PFA) and decalcified in Osteosoft (Osteosoft; 101728; Merck Millipore ...
-
bioRxiv - Biochemistry 2022Quote: ... or 300 mM (octamer-mix + APLFAD) ammonium acetate at pH 7.5 using 3 kDa MWCO Amicon Ultra Centrifugal Filter Units (Merck Millipore). After buffer exchange the volume of each sample was ∼40 µL ...
-
bioRxiv - Neuroscience 2022Quote: Tissues or cells were homogenized in Pierce IP Lysis buffer supplemented with protease inhibitor cocktail 3 (Merck Millipore, Darmstadt, Germany) and phosphatase inhibitor PhosSTOP (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... Germany) followed by size-fractionation using a 3 kDa centrifugal filter according to the manufacturer’s instructions (Merck KGaA, Darmstadt, Germany). The samples were kept at 4 °C or on ice throughout the process ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The eluted aliquots were then desalted with filtered water and concentrated using an ultrafiltration device with a 3 kDa cut-off membrane (Amicon Ultra-0.5 Centrifugal Filter Unit; Merck, UK) to remove any urea and salt residues.
-
bioRxiv - Biochemistry 2022Quote: ... as described by the manufacturer and dried down in a Speed-Vac concentrator (Thermo-Scientific) resuspended in 20 μl L/C water containing 3% acetonitrile (MeCN) (Merck) and 0.1% FA ...
-
bioRxiv - Neuroscience 2024Quote: ... animals at the age of 3 months were perfused using 2% Formaldehyde (Science Services, München, Germany) and 2.5% Glutaraldehyde (Merck, Darmstadt, Germany) in 0.1M Cacodylate buffer ...
-
bioRxiv - Plant Biology 2024Quote: ... the purified protein was concentrated by centrifugation in 3 kDa cut-off filters (Amicon Ultra-15 Centrifugal Filter Units, Merck) at 4,500 x g ...
-
bioRxiv - Plant Biology 2024Quote: ... the purified protein was concentrated by centrifugation in 3 kDa cut-off filters (Amicon Ultra-15 Centrifugal Filter Units, Merck) at 4,500 x g ...
-
bioRxiv - Plant Biology 2024Quote: ... The purified protein was concentrated by centrifugation in 3 kDa cut-off filters (Amicon Ultra-15 Centrifugal Filter Units, Merck) at 4500 × g ...
-
bioRxiv - Neuroscience 2024Quote: ... before being cut into 250μm parasagittal slices using a McIlwain tissue chopper and placed on Millicell membrane (3 to 4 slices each per animal, 0.4 μm membranes, Merck Millipore) in 50% BME (41010026 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the beads were washed 3 more times with 100 µL lysis buffer 2 supplemented with 100 µg/mL polyU RNA (Merck). The bound complexes were eluted in lysis buffer 2 containing 25 mM glutathione or 5 mM biotin (Merck) ...
-
bioRxiv - Immunology 2024Quote: The viabilities of the PBMCs or U-937 macrophages were analyzed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Biochemistry 2024Quote: Exoproteome fractions were concentrated to 1 mg mL-1 total protein (approximately 10 times concentration) using an Amicon Ultra-0.5 Centrifugal Filter Unit with a molecular weight cutoff of 3 kDa (Merck Millipore). A 10 µL aliquot of the concentrated exoproteome fraction was reduced with 5 mM tris (2-carboxyethyl ...
-
bioRxiv - Microbiology 2023Quote: ... were pre-prepared by washing 3 times in immunoprecipitation buffer then resuspended in 200μl immunoprecipitation buffer and coated with 2 μl FLAG M2 (Merck Millipore) or IgG (Merck Millipore ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the DNA was degraded for 3 min at 37LJ and 300 rpm using 45 mU/mL MNase (#N3755, Merck) and 36 U/mL DNase (#EN0521 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 µg of the digested RNA was reverse-transcribed as described above and validated by PCR using the KOD Xtreme HotStart Polymerase Kit (#71975-3; Merck, PCR program ...
-
bioRxiv - Biochemistry 2023Quote: ... membrane using wet transfer for 3 h at 90 V/4 °C in transfer buffer (25 mM Tris; 192 mM glycine, Merck; 20% methanol, Merck). Afterwards ...
-
bioRxiv - Molecular Biology 2023Quote: ... The lysate was supplemented with calcium chloride to a final concentration of 3 mM and chromatin was solubilised for 2 h at 4 °C by digestion with Turbonuclease (T4330, Merck) to a final concentration of 250U/ml ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Biophysics 2023Quote: ... The C378A or C406A variants of 15N-pm-β2AR-Cter were labeled on the remaining cysteine using 3-(2-Iodoacetamido)-proxyl (Merck). Paramagnetic samples were recorded with a recycling delay of 2 s ...
-
bioRxiv - Biophysics 2023Quote: ... The purified Nup98 was concentrated to a final concentration of 165 µM using 3-kDa MWCO centrifugal filters (Merck Millipore) in a solution of 2 M GdmCl ...