Labshake search
Citations for Merck :
901 - 950 of 2184 citations for Alpha Cyclodextrin Solution 5% w v since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Water used to prepare sample solutions or buffers was obtained from Merck Millipore ...
-
bioRxiv - Microbiology 2023Quote: ... infected macrophages were lysed for 15 min with 0.05% IGEPAL solution (Merck) after 3 h of internalization (day 0 ...
-
bioRxiv - Biophysics 2023Quote: ... A solution was prepared by mixing 70 µL human plasma fibronectin (Merck), 20 µL green fibrinogen and 910 µL PBS ...
-
bioRxiv - Neuroscience 2023Quote: A stock solution of PAD4 inhibitor (Cl-amidine; 506282, Merck, Darmstadt, Germany) was dissolved in dimethyl sulfoxide (DMSO ...
-
bioRxiv - Cell Biology 2024Quote: ... the hESCs were stained with 200 μl 0.2% crystal violet solution (Merck) for 10 minutes at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were de-paraffinized and stained in Mayer’s hemalum solution (Merck Millipore) and counterstained in eosin Y solution (Merck Millipore) ...
-
bioRxiv - Neuroscience 2024Quote: ... The plates were pre-coated with Poly(ethyleneimine) solution (PEI; P3141, Merck) and natural mouse Laminin (23017015 ...
-
bioRxiv - Developmental Biology 2024Quote: ... samples were stored at 4 °C overnight in HypoThermosol preservation solution (Merck). Tissue was first minced in a tissue culture dish using scalpel ...
-
bioRxiv - Developmental Biology 2024Quote: ... samples were stored at 4 °C overnight in HyperThermasol preservation solution (Merck). Tissue was first minced in a tissue culture dish using scalpel ...
-
bioRxiv - Microbiology 2024Quote: ... we incubated the coverslips with 10% bovine serum albumin solution (BSA, Merck Life Science UK Limited ...
-
bioRxiv - Neuroscience 2024Quote: ... solution in DPBS or with methanol (32215, Merck Life Science, Milan, Italy) for 5-10 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... and incubated in papain solution (Merck, 0.4 mg ml-1 in PBS) at 37°C for 20 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... Goodiemix solution consists of 94.89 g/L MgSO4 7H2O (Merck Ref: 1.05886.1000), 1.11 g/L CaCl2 (Sigma-Aldrich Ref ...
-
bioRxiv - Microbiology 2024Quote: ... Kao and Michayluk vitamin solution (Merck, Cat. No. K3129; 10 mL/L). If the study was performed under anaerobic conditions ...
-
bioRxiv - Neuroscience 2024Quote: ... the solutions were added to AmiconTM 50kDa MWCO filter units (UFC505024, Merck) pre-rinsed with UltraPureTM distilled water ...
-
bioRxiv - Pathology 2024Quote: ... mice received a FITC-dextran solution (4 kDa, 40 mg/mL, Merck) by oral gavage at 10 µL/g of body weight to evaluate whole intestinal permeability in vivo ...
-
bioRxiv - Pathology 2024Quote: ... For Masson’s Trichrome staining the slides were fixed with Bouin solution (Merck) for 1 h at 56 °C followed by a washing step with tap water ...
-
bioRxiv - Cancer Biology 2024Quote: ... Mowiol-Dabco solution mounting medium (#81381 and #D27802 from Sigma-Aldrich Merck); DAPI (#32670 from Sigma-Aldrich Merck) ...
-
bioRxiv - Developmental Biology 2024Quote: ... sections were incubated with a solution of secondary antibodies and DAPI (Merck) diluted in PBS for 1 hour ...
-
bioRxiv - Bioengineering 2021Quote: ... hiPSCs were transduced with LV particles at MOI of 5 in the presence of 5 µg/mL of polybrene (Merck). Stably transduced cells were obtained upon selection with 0.3 µg/mL of puromycin for 6 days ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were washed with PBS and permeabilized for 5 min with 0.1% Triton X-100 in PBS and blocked with 5% ChemiBlocker (Merck-Millipore) in PBS for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl of standards or samples were injected onto SEQuant ZIC-pHILIC column (Merck, PEEK 150 × 2.1 mm, 5 µm). MS analysis was performed in negative-ion mode over the mass range from 200 to 1,000 m/z ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Bioengineering 2023Quote: ... 30 mL Expi293 cultures were transfected with HER2 expression plasmid and the supernatant harvested 5-7 days later via centrifugation at 300 G for 5 minutes followed by filtration (Steriflip 0.22mm Merck, SCGP00525). HER2 was then purified from supernatant as previously described (Vazquez-Lombardi et al. ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Plant Biology 2024Quote: ... The extracts were spotted on a 5 cm x 5 cm TLC Silica gel 60 F₂₅₄ plate (Merck, Darmstadt, Germany). The blots were stained by spraying with a methanolic solution including 1% diphenylboric acid 2- aminoethylester (DPBA ...
-
bioRxiv - Genetics 2024Quote: ... 90%, 100% ethanol, 5 min each), cleared in xylene (twice, 5 min each) and mounted with DPX mounting medium (Merck).
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Microbiology 2022Quote: ... was prepared using 5× M9 minimal salts (Merck), diluted as appropriate ...
-
bioRxiv - Immunology 2020Quote: ... 0.1 mg/mL 3,5,3’,5’-tetramethylbenzidine (TMB, Merck) and 0.003% (v/v ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg H3K27me3 antibody (17-622, Merck-Millipore). For quantitative comparison of CTCF binding between WT and CTCF-AID cells ...
-
bioRxiv - Biochemistry 2020Quote: ... PBST/5% milk powder or ChemiBLOCKER (Merck KGaA). After further washing ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4NQO (CAS: 56-57-5) was from Merck Life Science (Espoo ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-HT (Serotonin creatinine sulfate monohydrate, H7752, Merck), m-CPBG (1-(3-Chlorophenyl)biguanide hydrochloride ...
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 5 µg/ml insulin (Merck, I5500), 1.8×10-4 M adenine (Merck ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5 µg/ml Apo-Transferrine (Merck, T2036). Explants were removed after 7 days once half of the membrane had been covered with keratinocytes and the culture was maintained by changing media every three days ...
-
bioRxiv - Immunology 2022Quote: ... 5 - 15 mM PEG-3000 (Sigma and Merck), 20 - 30 µM CA-074Me (Calbiochem) ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Biophysics 2022Quote: ... using spin filters (Merck, Millipore, MWCO: 5 kDa).
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked with 5% BSA (Merck KGaA) in TBS (Merck KGaA ...
-
bioRxiv - Biochemistry 2020Quote: ... Slides were later stained with 5% Giemsa (Merck) for 4 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% DMSO and 5% normal goat serum (Merck) for 1 h at RT and incubated overnight with primary antibodies ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 µg/ml holo-transferrin (Merck, cat. #T0665), 5 ng/ml EGF (Merck ...
-
bioRxiv - Synthetic Biology 2023Quote: ... supplemented with benzonase (5 μL/g pellet, Merck) and incubated for 15 min on a shaking table ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were suspended in 5% BSA (Merck; #12659) in PBS and single cells were sorted using a BD FACSJazz system into wells of a 96-well cell culture plate ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescein-labelled ssDNA substrate (5’[FAM]-pT50; Merck) was used in all SEC experiments to allow us to characterise complexes formed on DNA in the absence of any unwinding.
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 5 % heat-inactivated horse serum (Merck), EGF (20 ng mL−1 ...
-
bioRxiv - Biochemistry 2024Quote: ... Blocking with 5% bovine serum albumin (Merck, 126575) was used for rabbit anti-LC3B-I/II (1:3000 ...