Labshake search
Citations for Merck :
751 - 800 of 863 citations for Recombinant Mouse Icam1 Fc His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Whole cell samples were then analysed by immunoblot using anti-puromycin antibody (1:2000, anti-mouse, clone 12D10, Merck). As a loading control a duplicate SDS-PAGE was performed ...
-
bioRxiv - Neuroscience 2023Quote: ... The HRP-Conjugated secondary antibodies((Anti-Rabbit (raised in goat) and anti-Mouse (raised in goat)) were from Merck. ...
-
bioRxiv - Plant Biology 2023Quote: ... diluted 1:1000 in 1xTBST buffer (50 mM Tris, 150 mM NaCl, 0.1% Tween 20) and the anti-mouse secondary antibody (Merck) diluted 1:10000 in 1xTBST ...
-
bioRxiv - Molecular Biology 2023Quote: ... This was followed by application of a Cy3-conjugated goat anti-mouse antibody (1:250 dilution, #AP124C; Merck Millipore) as the secondary antibody ...
-
bioRxiv - Microbiology 2024Quote: ... insulin and proglucagon were measured using the Luminex™ Mouse Metabolic Hormone Expanded kit (Merck & Co., Inc. Kenilworth, NJ). Also ...
-
bioRxiv - Cancer Biology 2024Quote: The following primary antibodies and dilutions were used: mouse-anti-γH2AXSer139 1:1,000 (#05-636, clone JBW301, Merck Millipore) and rabbit-anti-53BP1 1:1,000 (NB#100-304 ...
-
bioRxiv - Neuroscience 2024Quote: ... The blocking solution was then replaced with another consisting of 2 µL mouse anti-NeuN antibody (Merck Millipore, MAB377) and 0.5 µL of rabbit anti-GFAP antibody (Agilent ...
-
bioRxiv - Physiology 2024Quote: ... Membrane was incubated overnight at 4°C with specific mouse monoclonal primary antibody anti-puromycin (Merck, MABE343, 1:1000) and after wash ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated with FITC (Fluorescein isothiocyanate) conjugated secondary antibody (0.5 μg/ml of Goat Anti-Mouse IgG-FITC in 5%BSA) (GeNei, Merck, USA) (Cat.no ...
-
bioRxiv - Cancer Biology 2022Quote: ... Primary antibodies were detected with HRP-conjugated anti-rabbit or anti-mouse IgG and visualised with Immobilon Western HRP substrate (Merck).
-
bioRxiv - Immunology 2021Quote: ... or 1 × 105 BM-DCs (mouse) per condition were pre-incubated for 1h prior to viral stimulation or infection with inhibitors MG132 (10μM; Merck Millipore) BafA1 (0.5μM ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed once and then incubated with the appropriate fluorescently labelled secondary antibody (anti-mouse polyvalent Ig-FITC (Merck) or anti-His6 HIS.H8 DyLight 488 ...
-
bioRxiv - Neuroscience 2020Quote: ... Secondary antibodies, anti-rabbit IgG-HRP (1:5000, #7074, CST) or anti-mouse-HRP (1:10000, #12-349, Merck Millipore) in TBST containing 5% milk for 1 h at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... and then incubated overnight at room temperature in darkness with the primary antibody solution containing mouse anti-vesicular Glutamate Transporter 1 (vGLUT1, 1:1000, MAB5502, Merck) or rabbit anti-Glutamate Decarboxylase 65-67 (GAD 65-67 ...
-
bioRxiv - Neuroscience 2020Quote: ... The blots were blocked in PBS/ 0,05%Tween20 containing 5% skim milk and then probed with the following primary antibodies over night at 4°C: mouse anti-P53 (1:100, Merck), rabbit anti-H2AX (1:1000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... blocked with 10% bovine serum albumin (BSA) 30 min at 37°C and incubated with primary anti-γH2A.X mouse antibodies (Merck Millipore) or rabbit anti-LC3B antibodies (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mouse LL/2 (LLC1; ATCC no. CRL-1642; obtained in 2015) was grown in BME with Earle′s salts (Merck) with the same supplementation as mentioned above ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Sections containing SN and VTA were incubated with antibodies directed against tyrosine hydroxylase (mouse monoclonal, 1:1000, Merck-Millipore MAB318) and mCherry (rabbit polyclonal ...
-
bioRxiv - Neuroscience 2020Quote: ... and then incubated overnight at room temperature in darkness with the primary antibody solution containing mouse anti-vesicular Glutamate Transporter 1 (vGlut1, 1:1000, MAB5502, Merck) and rabbit anti-Glutamate Decarboxylase 65-67 (GAD 65-67 ...
-
bioRxiv - Cell Biology 2022Quote: ... and SDS-PAGE and immunoblots were performed by standard methods using a mouse monoclonal anti-MYC antibody (clone 4A6, 05-724, Merck).
-
bioRxiv - Bioengineering 2020Quote: ... or mouse monoclonal β-actin antibody (1:1000 dilution; catalog no. catalog no. MAB 1501; Merck Millipore, Burlington, MA, USA) at room temperature for 1 hour ...
-
bioRxiv - Bioengineering 2019Quote: ... Tween 20 with 3 % (w/v) skim milk powder and successively incubated with monoclonal mouse anti-T7 RNA polymerase antibodies (Novagen, Merck) and POD labelled goat anti-mouse antibodies (Sigma) ...
-
bioRxiv - Molecular Biology 2019Quote: ... followed by washing and staining with horseradish peroxidase-conjugated donkey anti-rabbit or anti-mouse IgG secondary antibodies (1:5,000 dilution; Merck Millipore), respectively ...
-
bioRxiv - Neuroscience 2019Quote: ... AB5543), chicken anti-β3 tubulin (1:500, AB9354) and mouse anti-ankyrin G (1:500, MABN466) were purchased from Merck Millipore ...
-
bioRxiv - Molecular Biology 2021Quote: ... Secondary antibodies fused to HRP were used for detection (Goat anti-mouse HRP 1:3000, BioRad; Goat anti-rat HRP 1:3000, Merck Millipore ...
-
bioRxiv - Genetics 2021Quote: ... a mouse anti-glyceraldehyde-3-phosphate dehydrogenase monoclonal antibody (#MAB374, used at 1:10,000 for the Western blot analyses, Merck Millipore); a rabbit anti-LC3B polyclonal antibody (#2775 ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were incubated with mouse monoclonal Alexa Fluor-488 conjugated antibody against NeuN (1:200, MAB377X, Merck Millipore, MA, USA) or the rabbit polyclonal primary antibody against DISC1 (1:250 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The following antibodies were used for ChIP analysis: Mouse anti-RNA polymerase II antibody clone CTD4H8 (Merck Millipore, 05-623), Rabbit anti-NF-kB p65 antibody clone D14E12 (Cell Signalling ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were incubated with secondary antibodies conjugated with PLA probes MINUS and PLUS: the PLA probe anti-mouse PLUS and anti-rabbit MINUS (Merck). Incubation with all antibodies was accomplished in a humidified chamber for 1 h at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... one mouse was exposed by drinking water to a mixture of BPA (1 µM, CAS no. 80-09-1, Merck) and DEHP (1 µM ...
-
bioRxiv - Molecular Biology 2023Quote: The shRNA sequence in pLKO.3-GFP lentiviral vector against mouse KIS was GAGTGCGGAGAATGAGTGTTT (MISSION shRNA library, TRCN0000027622) and control non-mammalian shRNA was from Merck-Sigma (SHC002) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were run on SDS-PAGE and the expression of IDO1 was analyzed with a mouse anti-IDO1 antibody (clone 8G-11, Merck). Mouse monoclonal Ab against β-tubulin (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... after testing multiple antibodies (anti-NeuN rabbit Antibody, ABN78 & ABN78C3, Merck; anti-NeuN rabbit Antibody, ab177487, Abcam; anti-NeuN mouse Antibody, MAB377, Merck) and increasing antibody concentrations (up to 1:50) ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by incubation with a rabbit anti-Kv4.3 primary antibody (1:10000, Alomone Labs) together with chicken (G)/mouse (L) anti-TH primary antibody (1:1000, Abcam / Merck) in a carrier solution (1% NGS ...
-
bioRxiv - Cell Biology 2023Quote: Proximity ligation assays with Aurora A kinase and MP-GAP were performed in HeLa cells using mouse anti-Aurora A Kinase antibody (1:500, A1231 Merck), rabbit anti-MP-GAP antibody (1:250 ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were incubated for 1 h at RT with a mouse anti-2A primary antibody (cat. no. MABS2005, Merck) diluted 1:2000 in 1% (w/v ...
-
bioRxiv - Microbiology 2023Quote: ... the fixation procedure above with and without subsequent membrane permeabilization was used in infected/uninfected organoids that were then stained with a mouse monoclonal anti-mitochondria antibody Cy3 conjugate (Merck) incubated overnight at 4 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... Then these samples were incubated in Alexa Fluor 488 conjugated mouse monoclonal anti-CTSK antibody (1:100) at 4°C overnight (Merck) and then for 1h under agitation at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated overnight with an anti-GFP rabbit antibody (0.5 μg/ml) (Tamamaki et al., 2000) and an anti-Cre recombinase mouse monoclonal antibody (1:1,000; MAB3120, Merck Millipore). After a rinse ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:10,000 WB) and mouse monoclonal antibody recognizing the N-terminus β-Actin (#A5441, 1:10,000 WB) were purchased from Merck. Rabbit polyclonal phosphomyosin (Thr18/Ser19 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... CDK9 was immunoprecipitated with 15μg of an anti-CDK9 antibody (D-7, sc-13130, lot no # B1422) or control mouse IgG (12-371, Merck) in IP Buffer with 2X SDS buffer (100mM NaCl ...
-
bioRxiv - Neuroscience 2024Quote: ... we cloned the cytoplasmic domain of AChRα (mouse; amino acid 317-428) with or without mCherry into pGEX-4T1 (Cytiva 28-9545-49; Merck). GFP-SH3BP2 with or without the intrinsic disorder domain (amino acid 164-449 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Chromatin immunoprecipitation was performed using 5-10 μg of primary mouse monoclonal ANTI-FLAG® M2 antibody (Merck, F1804-200UG) in 250 μL LB3 with 1% Triton X-100 overnight at 4 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... the culture was stimulated by substituting one third of the medium with L929 medium (L929 mouse fibroblast cells had previously been plated in T175 cm2 cell culture flasks (Corning, Merck) with 100 mL culture medium (DMEM ...
-
bioRxiv - Plant Biology 2024Quote: ... Phosphorylated SR proteins were detected using a mouse monoclonal α-pan-phosphoepitope SR-specific antibody (1H4, Merck, Catalogue-No.: MABE50) at 0.025 µg/mL ...
-
bioRxiv - Biophysics 2021Quote: ... The antibody was revealed using Atto 594 goat anti-mouse IgG (1:500, 76085-1ML-F, Merck & Co., Kenilworth, NJ, USA). The coverslips were rinsed in PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were blocked in 5% skim milk in TBS for 1 hour and probed with mouse γ/9d 2G10.2 (1:1000, MERCK MABT1335), rabbit anti mouse IgG (1:3000 ...
-
bioRxiv - Immunology 2021Quote: ... Mouse peritoneal macrophages (MPMs) were isolated from mice 4 d after the intraperitoneal injection of thioglycollate (Merck & Co.; Kenilworth, NJ, USA) as described previously(Zhang et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... The sections were collected in PBS in 24-well plates and processed for free-floating immunofluorescence using primary polyclonal antibodies that label neurons (NeuN, mouse; 1: 1000, Millipore MAB377, Merck Millipore), reactive astrocytes (GFAP ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... the slides were incubated for 1 h at room temperature with the appropriate biotin-conjugated secondary antibody: goat anti-mouse (21538, Merck-Millipore) for CD3 and goat anti-rat (BP-9400 ...