Labshake search
Citations for Genesee Scientific :
1 - 50 of 170 citations for Creatinine Serum Low Sample Volume Kit 384 well Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... 96 well and 384 well plates used in these studies were obtained from Genesee Scientific (San Diego ...
-
bioRxiv - Cancer Biology 2024Quote: PDX4 SE and PDX4 CR cells were seeded at low density in 48-well plates (20 cells/well; n=24 per plating; 25-108MP; Genesee Scientific) for 10 days ...
-
bioRxiv - Genetics 2023Quote: ... 12-well plates (Genesee, 25-101) were used ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Each 48-well screening plate (Genesee Scientific) assayed 8 planarians in the solvent control (0.5% DMSO or IO water) ...
-
bioRxiv - Cell Biology 2019Quote: ... and 2 × 105 recipient cells/well (A549) in 6-well plates (Genesee Scientific) were reverse transfected with 5 nM siRNA using Lipofectamine RNAiMAX (ThermoFisher) ...
-
bioRxiv - Biochemistry 2021Quote: ... 96 well microtiter plates were purchased from Genesee Scientific (San Diego ...
-
bioRxiv - Neuroscience 2022Quote: ... neurons were cultured in 12-well plate cell culture plates (Genesee Scientific; 25-106) and co-transfected with SYP-GFP and SYT1-HaloTag or HaloTag-SYT1 on 9 DIV using Lipofectamine LTX Reagent with PLUS Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Chemical stock plates were prepared in 96-well plates (Genesee Scientific, San Diego, CA) by adding 200X stock solutions from the highest tested concentration to one well of the plate ...
-
bioRxiv - Developmental Biology 2022Quote: ... coated 96-well culture plate (Genesee Scientific, 25-109). Cells were serum starved for 16 hours and cultured in serum-free DMEM/F12 GlutaMAX (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2022Quote: ... These needle cores were plated into wells of a 96-well plate (25-109, Genesee Scientific) pretreated with 1% Pluronic in 1x PBS buffer as described above ...
-
bioRxiv - Cell Biology 2022Quote: ... 20,000 cells were seeded into each well of a 24-well plate (Genesee, catalog # 25-107). Cells were grown to confluency using normal growth media ...
-
bioRxiv - Biophysics 2022Quote: ... in 24-well cell cultures plates (Genesee Scientific, 25-107) with coverslips (Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The planarians were maintained in 12-well plates (Genesee Scientific), with 6 planarians per well and a total volume of 1.2 mL of the test solution to keep the ratio of chemical/planarian consistent with the screening set-up ...
-
bioRxiv - Microbiology 2023Quote: ... 6-well culture plates with glass cover slips (Genesee, Fisher), 96 well plates (Costar) ...
-
bioRxiv - Microbiology 2023Quote: ... A black 96 well plate (Genesee Scientific cat # 91-424TB) was used to measure the fluorescence and a clear 96 well plate (Genesee Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were cultured in 6-well culture plates (Genesee Scientific), 6-well culture plates with glass cover slips (Genesee ...
-
bioRxiv - Cancer Biology 2024Quote: ... by forward scatter to a 96-well plate (Genesee Scientific). Twenty-one MIA PaCa-2 single-cell clones were established after approximately 3 weeks of culture ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... CRFK cells were plated in 96-well tissue culture plates (Genesee Scientific) in four well replicates with 5 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... CRFK cells were grown in 96-well tissue culture plates (Genesee Scientific) containing 200 μL culture media ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... planarians were kept in 12-well plates (Genesee Scientific, San Diego, CA), with 6 planarians per well and a total volume of 1.2 mL ...
-
bioRxiv - Cell Biology 2022Quote: ... and 8 after being plated in 12-well plates (Genesee, catalog # 25106) in triplicate at a density of 40,000 cells/well ...
-
bioRxiv - Microbiology 2020Quote: ... were grown and assayed in 96-well plates (Genesee, El Cajon, CA).
-
bioRxiv - Immunology 2022Quote: ... were grown and assayed in 96-well plates (Genesee, El Cajon, CA).
-
bioRxiv - Biochemistry 2023Quote: Tissue culture 6-well plates (Genesee Scientific, USA; cat. no. 25-105)
-
bioRxiv - Neuroscience 2023Quote: ... Cells were grown in 12-well culture plates (Genesee Scientific; 25-106); HEK293T cells were transfected 1 day after splitting ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and their tails were randomly placed in separate wells of a 48-well plate (Genesee Scientific, San Diego, CA) (1 worm/well ...
-
bioRxiv - Immunology 2023Quote: Macrophages were seeded at 1x106 cells/well in 6-well non-TC treated plates (Genesee Scientific, Cat. 25-100). Cells were infected as described above ...
-
bioRxiv - Physiology 2020Quote: ... re-suspended and re-plated onto poly-D-lysine coated 96-well plates (Krystal black walled plates, Genesee Scientific) at 5×105 cells/mL (100 μL/well ...
-
bioRxiv - Microbiology 2022Quote: ... and Mtb were grown to mid-log phase and diluted to an OD600 = 0.003 in each well of non-treated 96-well plates (Genesee Scientific) containing 100 μL of antibiotic serially diluted in 7H9 + OADC + 5 μg/mL clavulanate (Sigma Aldrich) ...
-
bioRxiv - Genetics 2022Quote: ... we transfected approximately 200ng vector into approximately 25,000 293T cells per well in white 96 well tissue culture plates (Genesee Sci) using the TransIT-LT1 transfection reagent (Mirus Bio ...
-
bioRxiv - Cell Biology 2023Quote: ATF4-mApple reporter cells were seeded at a density of 300,000 cells per well in 6-well TC-treated flat bottom plates (Genesee Scientific). The following day ...
-
bioRxiv - Cell Biology 2020Quote: ... 96-well cell culture plates (cat. 25-109, Genesee Scientific, El Cajon, CA) by transferring 100 μl of suspension to each well using a multichannel pipette resulting in a final surface density of 2,000 cells/well.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... CRFK cells were grown in a 96-well tissue culture plate (Genesee Scientific) until the CRFK cells achieved approximately 75-85% confluency ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... CRFK cells were cultured in a 6-well tissue culture plate (Genesee Biotek). At approximately 75-85% cellular confluency ...
-
bioRxiv - Neuroscience 2023Quote: HEK293T cells were seeded in a 6-well plate (Genesee Scientific, 25-105) at a density of 0.2 x 106 in 2 ml of complete media as described above ...
-
bioRxiv - Cell Biology 2023Quote: ... OP9 cells were seeded into 96-well flat-bottomed plates (Genesee, 25-109). Once confluent ...
-
bioRxiv - Microbiology 2022Quote: Serum samples were serially diluted in RPMI-1640 with 10 mM HEPES and 2% FetalPure bovine serum (Genesee Scientific 25-525H), hereafter referred to as viral diluent ...
-
bioRxiv - Microbiology 2021Quote: The growth curve assays were performed in 96 well tissue culture plates (Genesee Scientific) using a Spark 10M multimode microplate reader (Tecan ...
-
bioRxiv - Genomics 2021Quote: ... and SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT).[1] Post-PCR cleanup was performed by removing the STAMPs and pooling the supernatant from the wells together into a single 1.7 mL low-retention tube (Genesee Scientific, #22-281LR) along with 0.6X Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2019Quote: ... The sacculi hydrolysis assay was set up in non-treated 96-well plates (Genesee Scientific). To each well ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: 24 h starved polyps were incubated in 6-well plates (Genesee Scientific, El Cajon, CA), 8 or 10 animals per well in 2 mL of different concentrations of linalool (0-10 mM ...
-
bioRxiv - Immunology 2020Quote: All immunoprecipitation experiments were conducted in 2 ml deep-well polypropylene plates (Genesee Scientific, Inc). Plates were blocked with 3% BSA in TBST overnight with overhead rotation on a Rotator Genie prior to use for immunoprecipitations ...
-
bioRxiv - Synthetic Biology 2023Quote: Microfermentations were conducted in 96-well plates (Genesee Scientific, San Diego, CA, Cat#25-104) using a previously reported method 43,46,86 ...
-
bioRxiv - Cell Biology 2022Quote: Glass coverslips (Fisherbrand, 12-545-80) were placed in 24-well plates (Genesee Scientific, 25-107) and coated in 3 μg/mL of fibronectin (EMD Millipore ...
-
bioRxiv - Biophysics 2022Quote: Glass coverslips (Fisherbrand, 12-545-80) were placed in 24-well plates (Genesee Scientific, 25-107) and coated in 3 μg/mL of fibronectin (EMD Millipore ...
-
bioRxiv - Neuroscience 2022Quote: ... using low-binding pipette tips (Genesee Scientific) and stored at −80°C before analysis ...
-
bioRxiv - Cell Biology 2022Quote: ... and stored at -20°C in a sealed 96-well PCR plate (Genesee Scientific, cat#24-302).
-
bioRxiv - Molecular Biology 2021Quote: ... 1 mL cold neutralized collagen solution was added to 6-well tissue culture plates (Genesee 25-105) pre-warmed to 37 °C ...
-
bioRxiv - Microbiology 2023Quote: ... was used to measure the fluorescence and a clear 96 well plate (Genesee Scientific, cat # 25-104). was used to measure optical density ...
-
bioRxiv - Microbiology 2020Quote: Enzyme turnover assays were performed at 37°C in 96 well clear bottom plates (Genesee Scientific, #25-104) in a Synergy HTX plate reader in 200µL PBS using 200µM NADPH ...