Labshake search
Citations for Genesee Scientific :
1 - 30 of 30 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... Each PCR reaction contained Sybr Green 2X Master Mix (Genesee Scientific), appropriate primer pairs (Figure 1A ...
-
bioRxiv - Molecular Biology 2024Quote: ... qPCR was performed with SYBR green (qPCRBIO SyGreen Blue Mix Separate-ROX 17-507B, Genesee Scientific), using 4μl of dilute cDNA in each 20μl reaction containing a final primer concentration of 200nM and 10μl of SYBR green buffer solution ...
-
bioRxiv - Bioengineering 2022Quote: ... RT-qPCR was performed with SYBR green (qPCRBIO SyGreen Blue Mix Separate-ROX Cat #: 17-507B, Genesee Scientific). 4 μl of diluted cDNA was used for each 20 μl reaction containing a final primer concentration of 200 nM and 10 μl of SYBR green buffer solution ...
-
bioRxiv - Bioengineering 2023Quote: ... RT-qPCR was performed with SYBR green (qPCRBIO SyGreen Blue Mix Separate-ROX Cat #: 17-507B, Genesee Scientific), using 4 μl of diluted cDNA for each 20 μl reaction containing a final primer concentration of 200 nM and 10 μl of SYBR green buffer solution ...
-
bioRxiv - Physiology 2024Quote: ... SYBR Green based real-time PCR was performed using Apex qPCR Master Mix (Genesee Scientific). PCR conditions were as follows ...
-
bioRxiv - Molecular Biology 2022Quote: ... in duplicate using Apex qPCR Green Master Mix (Genesee Scientific) and a CFX384 Touch Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Molecular Biology 2022Quote: ... in duplicate using Apex qPCR Green Master Mix (Genesee Scientific) and a CFX384 Touch Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Molecular Biology 2022Quote: ... in duplicate using Apex qPCR Green Master Mix (Genesee Scientific) and a CFX384 Touch Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: SYBRGreen based real-time PCR was performed using Apex qPCR GREEN Master Mix (Genesee Scientific, San Diego, CA, USA). The experiments were performed as triplicates of at least three independent experiments and are expressed as a ~fold change compared to the control ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... with 12.5 μL of Apex 2X RED Taq Master Mix (Genesee Scientific, San Diego, USA), 1 μL of the forward and reverse primer (5 μM) ...
-
bioRxiv - Developmental Biology 2021Quote: ... qPCR was performed with Apex Probe Master Mix (cat. 42-116P, Genesee, California, USA), TaqMan Gene Expression Probes (Thermofisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: All qPCR experiments were performed in biological triplicate and technical duplicate using qPCRBIO SyGreen Blue 2x reaction mix (Genesee Scientific 17-505B) and analyzed on a QuantStudio3™ Real-Time PCR System (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Amplifications with primer sets were performed in a final volume of 25 μL using 12.5 μL 2X Apex Taq red master mix (Genesee Scientific, San Diego, CA), 1.25 μL each of 10-μM forward and reverse primers and 3 μL of DNA template ...
-
bioRxiv - Cancer Biology 2023Quote: ... we performed qRT-PCR of the cDNA using qPCRBIO SyGreen Blue Mix Hi-ROX (Genesee Scientific; Cat #17-506C) and the Applied Biosystems® ViiATM 7 Real-Time PCR System with 384-well Block (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... with 12.5μl Apex PCR Master Mix (Genesee Scientific, San Diego, California, USA), nine μl pure water ...
-
bioRxiv - Molecular Biology 2020Quote: ... qRT-PCR was performed in triplicate using 10μl reactions (2.5μl of cDNA, 5 μM of each forward and reverse primers, and 2x SYGreen mix (Genesee #17-505B)) ...
-
bioRxiv - Genomics 2021Quote: ... reactions were set up in 10 μl volumes with: 5 μl 2×Apex PCR Master Mix (Genesee Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... The generated cDNA was diluted 2x and 1µL was used for PCR amplification using PCR Biosystems VeriFi Mix (Genesee Scientific, 17-308B). A touchdown-PCR method was used for amplification ...
-
bioRxiv - Microbiology 2021Quote: ... Colonies of potential recombinant mutants were screened using colony PCR with 2.0 X Taq RED Master Mix (Genesee Scientific, USA). For colony PCR ...
-
bioRxiv - Neuroscience 2022Quote: ... using low-binding pipette tips (Genesee Scientific) and stored at −80°C before analysis ...
-
bioRxiv - Cell Biology 2021Quote: ... worms were carefully pipetted with low bind tips (Genesee Scientific, cat no. 23-121RS) to NGM plates ...
-
bioRxiv - Neuroscience 2024Quote: ... and antibiotic mix (Penicillin/Streptomycin)(Genesee Scientific, 25-512) and incubated at 37°C in 5% CO2 ...
-
bioRxiv - Developmental Biology 2023Quote: Drosophila were maintained at 25ºC on Jazz Mix medium (Genesee Scientific) for all experiments ...
-
bioRxiv - Cancer Biology 2024Quote: PDX4 SE and PDX4 CR cells were seeded at low density in 48-well plates (20 cells/well; n=24 per plating; 25-108MP; Genesee Scientific) for 10 days ...
-
bioRxiv - Genomics 2021Quote: ... and SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT).[1] Post-PCR cleanup was performed by removing the STAMPs and pooling the supernatant from the wells together into a single 1.7 mL low-retention tube (Genesee Scientific, #22-281LR) along with 0.6X Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2019Quote: ... The reaction (25 μL) contained: 10 μL APEX 2XRedTaq Mix (Genesee Scientific, USA), 5 pmol of each primer (see above) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Real-time Taqman-PCR was assembled in qPCRBIO Probe Blue Mix (Genesee Scientific Corporation, 17-514) or TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Real-time Taqman-PCR was assembled in qPCRBIO Probe Blue Mix (Genesee Scientific Corporation, 17-514) with 0.5μM of each primer (Forward ...
-
bioRxiv - Neuroscience 2023Quote: ... The resultant cDNA was mixed with primers (Integrated DNA Technology) and SyGreen Blue Mix (Genesee Scientific, 17-507) for RT–qPCR using the CFX384 real-time PCR system (BioRad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA was subjected to PCR analysis with gene-specific primers in the presence of SyGreen Blue Mix (Genesee). Relative mRNA abundance was obtained by normalization to actin and tubulin housekeeping genes.