Labshake search
Citations for R&D Systems :
1101 - 1150 of 10000+ citations for Surfactant Protein D SFTPD Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: To assess the levels of hippocampal BDNF protein the BDNF Quantikine ELISA kit (R&D Systems, Wiesbaden, Germany) was used ...
-
bioRxiv - Immunology 2020Quote: ... and CXCL12 protein concentration assayed with the Mouse CXCL12/SDF-1 alpha Quantikine ELISA Kit (R&D Systems) according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2022Quote: ... 50-100μg of protein lysate was treated for 6-8hrs with chABC (100 μU/mL; R&D systems) before being subjected to traditional western blotting ...
-
bioRxiv - Cancer Biology 2022Quote: For recombinant E6 proteins and sdAbs: 2 µg of E6 (R&D Systems Inc., Cat. # AP-120-025), MBP (Abnova ...
-
bioRxiv - Physiology 2021Quote: ... and mouse recombinant proteins of IL-6 and TNFα were brought from R&D system (Minneapolis, MN, USA). Mouse anti-eMyHC was purchased form Developmental Studies Hybridoma (DSHB ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant human MFG-E8 protein produced in mouse myeloma cells was purchased from R&D Systems (Minneapolis, MN).
-
bioRxiv - Neuroscience 2022Quote: ... Protein levels were measured using the Proteome Profiler Human Cytokine Array Kit (R&D Systems product number ARY005B) as per the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2022Quote: ... were immobilized and were treated with His-tagged recombinant neuronal pentraxin proteins (4 µg/mL, R&D Systems). The readout was HRP-conjugated anti-His tag antibody recognizing the pentraxin proteins (abcam).
-
bioRxiv - Immunology 2024Quote: ... Mouse and human ACE2 protein levels were quantified from lung homogenates by ELISA (R&D Systems #DY3437, #DY933).
-
bioRxiv - Immunology 2024Quote: ... following reagents were used in flow cytometry: recombinant human PD-L1 Fc chimera Biotin protein (R&D Systems); APC Streptavidin (Tonbo Biosciences) ...
-
bioRxiv - Cell Biology 2023Quote: ... Levels of protein phosphorylation were then detected using the Human phospho-kinase Array Kit (ARY003B, R&D Systems) according to the manufacturer’s instructions (Table S3) ...
-
bioRxiv - Immunology 2023Quote: Cytokine protein levels were determined either by ELISA (Enzyme-Linked ImmunoSorbent Assay) using kits from R&D Systems Inc ...
-
bioRxiv - Bioengineering 2023Quote: ... 96-well plates were coated with anti-mouse protein C polyclonal sheep IgG (R&D Systems, Minneapolis, MN) and incubated at 4°C overnight ...
-
bioRxiv - Pathology 2024Quote: ... Cell surface protein expression was performed by labeling 2×105 cells for KDR-PE (R&D Systems, FAB357P) + PDGFRα-APC (Cell Signaling ...
-
bioRxiv - Neuroscience 2023Quote: Recombinant Human Neuronal Pentraxin 1 Protein (NP1) was purchased from R&D systems (#: 7707-NP, bio-techne, USA).
-
bioRxiv - Cancer Biology 2024Quote: ... ENAS + 5 ng/ml TGF-β1 (Recombinant Human TGF-β1 Protein, R&D Systems, Cat. No. 240-B). Basal medium + solvent ...
-
bioRxiv - Immunology 2024Quote: ... coated with 1 µg/ml (volume 100 μl/well) of human recombinant IFN specific proteins (R&D Systems) in Phosphate Buffered Saline (PBS) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Following primary antibodies (αTFAP2A, Abcam ab108311; αTFAP2B, Abcam ab221094; αLEF1, Cell Signaling, 2230; αSOX2, R&D Systems, AF2018; αPITX1, Abcam ab70273; and αPITX2, R&D Systems, AF7388) were diluted in TBS (0.5% Tween in phosphate-buffered saline ...
-
bioRxiv - Molecular Biology 2019Quote: ... of LPS treated rats were double-immunostained for the analysis of the cellular localization of cathepsin X using the following primary antibodies: goat polyclonal anti-cathepsin X antibody (1:75, R&D System), mouse monoclonal anti-TH antibody (1:500 ...
-
bioRxiv - Cell Biology 2021Quote: ... The membrane was blocked with blocking buffer for 30 min at room temperature and followed by incubation with primary antibody overnight at 4°C (all primary antibodies used for dot blot were purchased form, R&D systems; anti-Cathepsin A ...
-
bioRxiv - Cell Biology 2021Quote: ... Bound antibody was detected using peroxidase-conjugated secondary antibodies (Sigma-Aldrich Company Ltd, Poole, U.K. and R&D Systems Ltd., Abingdon, U.K.) in conjunction with enhanced chemiluminescence detection reagents (Perbio Science Ltd. ...
-
bioRxiv - Biophysics 2022Quote: ... and human IL-13 (monoclonal capture antibody MAB213 and polyclonal detection antibody BAF213) were purchased from R&D Systems (Minneapolis, MN, USA).
-
bioRxiv - Neuroscience 2022Quote: ... Primary antibodies (Goat anti-GFP biotin conjugated, Vector Labs; sheep polyclonal anti-human-sema3f antibody, R&D systems; mouse anti-GADPH, Abcam) were diluted in the blocking buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... Incubation with primary rat-polyclonal antibody against LYVE-1 in combination with rat-polyclonal biotinylated anti-MHC-II antibody (both R&D Systems) was done for 2h at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... Cells were incubated overnight at 4°C with primary antibodies: sheep anti-THP polyclonal antibody (1:40, catalog no. AF5175; R&D Systems), goat anti-MPO polyclonal antibody (1:200 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The beads were rinsed with 200 µL MACSPlex buffer and detected after staining with APC-conjugated antibody mixture (anti-CD9/CD63/CD81) or AF647-conjugated anti-TSPAN2 antibodies (FAB7876R; R&D systems) for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-Cathepsin D (goat polyclonal from R&D systems), anti-LAMP2 (rat monoclonal from Abcam) ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-cathepsin D (Cat# MAB1029) from R&D systems, and anti-EEA (Cat# 1610456 ...
-
bioRxiv - Cell Biology 2020Quote: ... colonic tissues were incubated with a polyclonal antibody raised against c-Kit (mSCFR, R&D Systems, MN ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by incubation with antibodies against Nestin (MAB2736, 1:50, R&D Systems, Cambridge, MA, USA) or Ki-67 (NB600-1252 ...
-
bioRxiv - Cell Biology 2020Quote: ... and analyzed by SDS-PAGE and immunoblotting by using anti-Shh antibodies (R&D Systems, AF464). Signals were quantified with ImageJ and normalized to the highest protein amount detected in each run.
-
bioRxiv - Biochemistry 2022Quote: ... or 1:1000 anti-Human/Mouse/Rat PRL-3 Antibody (R&D Systems, MAB3219, Lot. WXH0419091). Following three washes with 0.1% TBST ...
-
bioRxiv - Bioengineering 2022Quote: ... The following primary antibodies were used in immunostaining: Anti-FOXA2 (R&D systems, #AF2400; 1:100), Anti-OLIG2 (Sigma ...
-
bioRxiv - Neuroscience 2021Quote: ... We used following primary antibodies and dilutions: anti-(murine)SorCS2 1:1000 (#AF4237, R&D Systems), anti-DARPP-32 1:1000 (#AB40801 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and TNF-α-treated CM with FGF-2 neutralizing antibody (NAb; AF-233, R&D Systems). On day 7 ...
-
bioRxiv - Developmental Biology 2022Quote: The primary antibodies used in this study included goat anti-FOXF1 (R&D Systems, AF4798; RRID:AB_2105588), goat anti-GATA4 (Santa Cruz Biotechnology ...
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and PTX3 levels were analyzed in duplicate using commercially available antibodies (all from R&D Systems, Minneapolis ...
-
bioRxiv - Neuroscience 2019Quote: ... and BSA (2%) and stained with following primary antibodies: PI16 (1:75, R&D Systems AF4929), GLUT1 (1:250 ...
-
bioRxiv - Neuroscience 2019Quote: ... The following primary antibodies were used in the study: PI16 (1:750, R&D Systems AF4929), α-SMA (1:1500 ...
-
bioRxiv - Cancer Biology 2019Quote: ... the following primary antibodies were used: mouse anti-human IFN-γ (R&D system, 1:1000), mouse anti-human ICAM1 (Abcam ...
-
bioRxiv - Cell Biology 2019Quote: ... The following antibodies were used: 1:100 goat anti-E-cadherin (R&D Systems (Minneapolis, MN)) ...
-
bioRxiv - Molecular Biology 2019Quote: ... or goat polyclonal primary antibody against cathepsin X (1:200, AF934, R&D Systems, MN, USA), diluted in blocking solution ...
-
bioRxiv - Physiology 2019Quote: ... Sections were incubated overnight at 4°C with primary antibodies against SOX9 (R&D Systems, AF3075), MMP13 (Protein Tech ...
-
bioRxiv - Developmental Biology 2021Quote: ... Unfixed cryopreserved embryos were sectioned and stained with sheep-anti-Prdm16 antibody (AF6295, R&D Systems) and FITC-conjugated anti-αSMA (F3777 ...
-
bioRxiv - Immunology 2021Quote: ... or 5 ug/ml isotype or neutralizing monoclonal anti-hIL-33 antibodies (R&D Systems, MAB36254), followed by stimulation with rIL-33 (Peprotech) ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies used for immunoblotting were sheep anti-DRAXIN (AF6149, R&D systems, 1 ug/mL), goat anti-β-ACTIN (AB0145-200 ...
-
bioRxiv - Bioengineering 2021Quote: ... the slides were incubated in 5 μg/mL solution of anti-SOX2 antibodies (R&D Systems) or 5 μg/mL solution of anti-Sox17 (SantaCruz ...
-
bioRxiv - Genomics 2020Quote: ... Antibodies used in this study were as follows: IL-33 (cat. no. BAF3626; R&D Systems), c-Jun (cat ...
-
bioRxiv - Neuroscience 2020Quote: Primary antibodies for immunoprecipitation and Western blotting included anti-V5 and anti-His (R&D systems), Mouse anti-VAMP2 (SySy Synaptic Systems ...