Labshake search
Citations for Santa Cruz :
1 - 50 of 82 citations for CRISPR Screening since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... myotubes were infected to deliver 1 µg of CRISPR/Cas9 plasmid (Santa Cruz CRISPR Plasmid) to delete MFN1 ...
-
bioRxiv - Physiology 2023Quote: ... myotubes were infected with 1 µg CRISPR/Cas9 (Santa Cruz Sam50 CRISPR Plasmid; sc-427129) to achieve Sam50 deletion ...
-
bioRxiv - Cell Biology 2019Quote: ... or CRISPR plasmid TRFC (Santa Cruz Biotechnologies ...
-
bioRxiv - Cell Biology 2020Quote: Commercially available CRISPR plasmids (Santa Cruz) were used to alter the expression of CD44 within the HCMEC/D3 cells prior to introduction into the 3D BBB model ...
-
bioRxiv - Cell Biology 2019Quote: CRISPR (Ran et al., 2013) knock out cell lines were generated using the CRISPR plasmid CD44 (Santa Cruz Biotechnologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... CRISPR plasmid was obtained from Santa Cruz Biotechnology (sc-431979) ...
-
bioRxiv - Molecular Biology 2019Quote: ... the commercially available CRISPR/Cas9 KO Plasmid BRCA2 CRISPR/Cas9 KO plasmid was used (Santa Cruz Biotechnology sc-406099). Transfected cells were FACS-sorted into 96-well plates using a BD FACSAria II instrument ...
-
bioRxiv - Cancer Biology 2021Quote: CRISPR knock-out plasmids were provided from Santa Cruz Biotechnology (sc-416469 ...
-
bioRxiv - Cell Biology 2022Quote: ... CRISPR/Cas9 Plasmid (Santa Cruz Biotechnology; catalog #sc-418922) containing non-targeting 20 nt scramble guide RNA was used as a control ...
-
bioRxiv - Cell Biology 2023Quote: ... or a CRISPR Control plasmid (Santa Cruz, sc-437281). The following day ...
-
bioRxiv - Developmental Biology 2023Quote: ... commercial CRISPR/Cas9 Knockout Plasmid (#sc-430618, Santa Cruz) and HDR plasmid (#sc-430618 ...
-
bioRxiv - Cancer Biology 2020Quote: ... BT549 and 4T1 cell lines with PI4KIIIβ deletion by CRISPR/Cas9 were generated by transfecting wildtype cells with CRISPR/Cas9 plasmid (Santa Cruz Biotechnology, Mississauga, Canada) followed by single cell FACS of green fluorescent cells into 96-well plates ...
-
bioRxiv - Cancer Biology 2020Quote: ... CRISPR overexpression plasmid DNA (Santa Cruz Biotechnology, sc-400171-ACT) was first added to OPTI-MEM medium (Gibco ...
-
bioRxiv - Cancer Biology 2024Quote: ... Solutions of 1 μg CRISPR (Santa Cruz Biotechnology, sc-404461) and DOCK7 HDR (h ...
-
bioRxiv - Cell Biology 2024Quote: ... CRISPR/Cas9 plasmids for control and SLC25A48-KO (Santa Cruz Biotechnology ...
-
bioRxiv - Immunology 2021Quote: Three different RIPK1 CRISPR/Cas9 knockout plasmids (Santa Cruz sc-400377) respectively encoding guide RNA targeting sequences GGCTTTGCGTTGACGTCATTC (gRNAa) ...
-
bioRxiv - Biophysics 2022Quote: ... and mitofilin (Mic60) CRISPR (sc-429376) (Santa Cruz Biotechnology, California, US), with the use of guide RNA (Table 2) ...
-
Three-Dimensional Mitochondria Reconstructions of Murine Cardiac Muscle Changes in Size Across AgingbioRxiv - Biophysics 2023Quote: ... and Mitofilin (Mic60) CRISPR (sc-429376) (Santa Cruz Biotechnology, California, US) (Table 2) ...
-
bioRxiv - Cell Biology 2023Quote: ... and Control CRISPR/Cas9 Plasmid (sc-418922) were purchased from Santa Cruz Biotechnology (Dallas ...
-
bioRxiv - Cell Biology 2022Quote: ... CRISPR MEF cells were generated using Double Nickase Plasmid (Santa Cruz Biotechnology) against mouse Nir2 and Nir3 genes ...
-
bioRxiv - Neuroscience 2021Quote: ... glypican-4 CRISPR/dCas9 lentiviral activation particles (sc-420640-LAC-2, Santa Cruz) were injected in the right CA1 region (AP-2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... we used a CRISPR-Cas9 approach with commercially available plasmids from Santa Cruz Biotechnology (sc-404395 and sc-404395-HDR ...
-
bioRxiv - Immunology 2024Quote: ... Mouse cosmc guide RNA and CRISPR/Cas9 plasmid were obtained from Santa Cruz Technology (sc-425587) ...
-
bioRxiv - Biochemistry 2019Quote: HEK293T Δσ1R cells were generated using the CRISPR-Cas9 gene deletion method (Santa Cruz). Human σ1R is tagged in pcDNA3.1 plasmid with Myc ...
-
bioRxiv - Neuroscience 2019Quote: Nix KO cell line was generated using Nix CRISPR/Cas9 plasmids from Santa Cruz Biotechnologies ...
-
bioRxiv - Neuroscience 2020Quote: cGAS depleted striatal cells were generated using cGAS CRISPR/Cas9 plasmids from Santa cruz Biotechnologies ...
-
bioRxiv - Cell Biology 2023Quote: ... a cocktail of three different CRISPR/Cas9 knockout plasmids (Santa Cruz Biotechnology (sc-408187)) each encoding Cas9 nuclease and one of three different RAD51AP1-specific gRNAs targeting exons 2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... αKO was transfected with Pccb CRISPR/Cas9 KO plasmid (Santa Cruz Biotechnology, sc-426258) and incubated for 48 hours ...
-
bioRxiv - Cancer Biology 2020Quote: ... the commercially available PARP14 CRISPR/Cas9 KO plasmid was used (Santa Cruz Biotechnology sc-402812). Transfected cells were FACS-sorted into 96-well plates using a BD FACSAria II instrument ...
-
bioRxiv - Molecular Biology 2021Quote: ... the commercially available CHAF1A CRISPR/Cas9 KO plasmid was used (Santa Cruz Biotechnology sc-402472). Transfected HeLa or 293T cells were FACS-sorted into 96-well plates using a BD FACSAria II instrument ...
-
bioRxiv - Immunology 2019Quote: ... of CRISPR-Cas9-expressing knock-out plasmid (DUSP11, sc-408162; control, sc-418922, both Santa Cruz). 48h after transfection (293 & 2934×4 ...
-
bioRxiv - Cancer Biology 2019Quote: ... WT KPC cells were transfected concurrently with Pik3ca CRISPR/Cas9 KO and HDR plasmids (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2019Quote: ... WT KPC cells were transfected concurrently with Egfr CRISPR/Cas9 KO and HDR plasmids (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2020Quote: ... GSC transfection was carried out by electroporation with 1μg of CRISPR Cas 9 plasmid (Santa Cruz) per one million cells in Amaxa mouse neural stem cell Nucleofector ...
-
bioRxiv - Cell Biology 2023Quote: IMP1 deletion was performed using the IGF2BP1 CRISPR/Cas9 knockout plasmid (Santa Cruz Cat# sc-401703) and IGF2BP1 HDR Plasmid (Santa Cruz Cat# sc-401703-HDR ...
-
bioRxiv - Cell Biology 2019Quote: ... cells that were modified by CRISPR/Cas9 were selected with 10 μg/mL puromycin (Santa Cruz Biotechnology). This concentration was chosen as it kills 100% of cells that do not have the puromycin resistance gene within 24 hours (10 ...
-
bioRxiv - Cell Biology 2019Quote: ... RNF2 knockout T80 clones were generated using the CRISPR-Cas9 Double Nickase plasmid synthesized by Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2021Quote: ... SUMO1 deletion was carried out in striatal cells using CRISPR/Cas-9 tools obtained from Santa Cruz, as described before[85 ...
-
bioRxiv - Immunology 2020Quote: ... Control T cells were transfected with 3 μg of control CRISPR/Cas9 Plasmid (sc-418922, Santa Cruz). Knock-out efficiency was confirmed by immunoblots to TERT (1:1000 ...
-
bioRxiv - Biophysics 2023Quote: ... a commercial CRISPR/Cas9-based gene editing kit was employed (Santa Cruz Biotechnology, cat. sc-416469-NIC) including constructs expressing Cas9-D10A nickase ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cells were transfected with commercially available CRISPR/dCas9 lentiviral activation particles (Santa Cruz Biotechnology, Dallas, TX). Cells (2*105 ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were co-transfected using a mix of 3 CRISPR/Cas9 Knockout Plasmids (sc-413781; Santa Cruz Biotechnology) targeting exons 11 (5’- CTT GTT CTC TTT CTC GAT GA– 3’ and 5’ - ACT TCT TGC ATT GAA AGA AC- 3’ ...
-
bioRxiv - Immunology 2019Quote: ... of CRISPR–Cas9-expressing knockout plasmids (MAVS, sc-400769-ko-2 and control, sc-418922, both Santa Cruz). Jurkat knock-out clones were generated by electroporation (Neon Transfection System ...
-
bioRxiv - Immunology 2019Quote: ... of CRISPR–Cas9-expressing knockout plasmids (MAVS: sc-400769-ko-2, RIG-I: sc-400812, both Santa Cruz) and Homology Directed Repair plasmids containing puromycin resistance gene (MAVS ...
-
bioRxiv - Cancer Biology 2020Quote: A375 IRE1 knock-out and scramble control were generated with CRISPR-Cas9 double nickase system (Santa Cruz Biotechnology) according to manufacturer’s protocol.
-
bioRxiv - Cell Biology 2020Quote: ... Knockout of PANX1 gene was carried out using pre-designed PANX1-KO CRISPR-Cas9 plasmids (Santa Cruz Biotechnology). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: Cells were transfected as described above with the double nickase CRISPR Cas9 plasmid (Santa Cruz, sc-424440-NIC) or a CRISPR Control plasmid (Santa Cruz ...
-
bioRxiv - Cancer Biology 2023Quote: B7-H3 (cd276) was knocked-out in tumor cell lines using CRISPR/Cas9 KO plasmids from Santa Cruz Biotechnology (human ...
-
bioRxiv - Cell Biology 2020Quote: ... Prelid1 and StARD7 genes were knocked out in C2C12 cells by transfecting CRISPR/Cas9 mouse plasmids from Santa Cruz using Viafect Transfection Reagent (Promega E4982) ...
-
bioRxiv - Cancer Biology 2022Quote: CP70 cells were used to generate LCK CRISPR/Cas9 knockout cells according to the manufacturer protocol (Santa Cruz Biotechnology). Briefly ...