Labshake search
Citations for Becton, Dickinson and Company :
1 - 50 of 331 citations for rno mir 155 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 12 μl Bead RT/PCR Enhancer reagent from BD Biosciences and 72 μl nuclease free water for a total volume of 200 μl ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Microbiology 2023Quote: Mycobacterium smegmatis mc2 155 cells were grown in Middlebrook 7H9 medium (BD Biosciences) supplemented with 0.2 % glycerol and 0.05 % Tween 80 at 37 oC with shaking at 200 rpm ...
-
bioRxiv - Immunology 2021Quote: ... Cytofix/Cytoperm buffer set (BD Biosciences) was used ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... transcription factor buffer set (BD Bioscience) was used according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... or FoxP3 Buffer Set (BD Bioscience) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... or FoxP3 Buffer Set (BD Biosciences) according to the manufacturer’s instructions for surface and intranuclear staining respectively ...
-
bioRxiv - Immunology 2021Quote: ... Mouse TNF Flex Set (BD, 558299), Mouse MCP-1 Flex Set (BD ...
-
bioRxiv - Immunology 2023Quote: ... Angiogenin and Fractalkine were measured by BD CBA flex sets (BD Biosciences, US) according to the manufacturer’s guidelines ...
-
bioRxiv - Biochemistry 2024Quote: ... 21G needle collection set (BD Vacutainer) and collected in K2E EDTA tubes (BD Vacutainer) ...
-
bioRxiv - Immunology 2021Quote: The following flex sets were used: Mouse IFN-γ Flex Set RUO (A4) (BD Bioscience, Cat. 558296); Mouse Il-13 Flex Set RUO (B8 ...
-
bioRxiv - Immunology 2023Quote: ... Human IFN-γ ELISA Set (555142) and Human IL-2 ELISA Set (555190) were purchased from BD OptEIA™ ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and remaining reagents from BD OptEIA Reagent Set B (BD Biosciences, 550534). ELISAs were performed with 96-well MaxiSorp plates (Thermo Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Mouse MCP-1 Flex Set (BD, 558342), and Mouse IL-10 Flex Set (BD ...
-
bioRxiv - Cancer Biology 2022Quote: ... a set volume of CountBright beads (BDBiosciences) was added to each PKCα-KR sample as indicated ...
-
bioRxiv - Immunology 2022Quote: ... and TMB Substrate Reagent Set (BD Pharmingen) were used ...
-
bioRxiv - Immunology 2023Quote: ... the BD Pharmingen Transcription Buffer Set (BD Biosciences ...
-
bioRxiv - Immunology 2023Quote: ... The Transcription Factor Buffer Set (BD Biosciences) was substituted for 4% PFA and FACS Perm 2 when staining for transcription factors ...
-
bioRxiv - Cancer Biology 2023Quote: ... human IL8 Flex Set (558277; BD Biosciences), or human MCP-1/CCL2 Flex Set (558287 ...
-
bioRxiv - Plant Biology 2024Quote: ... the truncated HAF2 coding regions were obtained by RT-PCR from Col-0 cDNA and then cloned into pEXPAD502 (AD) and pDBLeu (BD) backbone ...
-
bioRxiv - Immunology 2023Quote: ... A target primer panel was constructed by combining a commercial predesigned Human T Cell Expression Primer Panel (BD Biosciences, 259 target primers) with our custom-designed primer panel (BD Biosciences) ...
-
bioRxiv - Immunology 2021Quote: The Mouse IFN-γ ELISPOT set (BD 551083) was used as directed by the manufacturer ...
-
bioRxiv - Immunology 2021Quote: ... and Mouse IL-10 Flex Set (BD, 558300). The cytokine level in the supernatant was reflected by the median fluorescence intensity (MFI ...
-
bioRxiv - Immunology 2020Quote: ... Proliferation: PE mouse anti-human Ki67 set (BD Biosciences Cat# 556027 ...
-
bioRxiv - Immunology 2021Quote: ... The Transcription Factor Buffer Set (BD Biosciences, 562574) was used for exposing nuclear antigens ...
-
bioRxiv - Immunology 2022Quote: A mouse IFN-γ ELISPOT set (BD 551083) was used as directed by the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: ... /Negative Control Compensation Particles Set (BD κ Biosciences) for mouse antibodies ...
-
bioRxiv - Immunology 2019Quote: ... The Transcription Factor Buffer Set (BD Biosciences, 562574) was used for exposing nuclear antigens ...
-
bioRxiv - Immunology 2020Quote: ... and the Transcription Factor buffer set (BD Biosciences), respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... set in deep 6-well plates (BD, #355467). Fibroblasts were allowed to condition the collagen plug overnight prior to 1.0 × 106 keratinocytes being added per collagen plug ...
-
bioRxiv - Immunology 2020Quote: ... the Mouse IFN-γ ELISPOT set (BD 551083) was used as directed by the manufacturer ...
-
bioRxiv - Immunology 2022Quote: ... and the Transcription Factor buffer set (BD Biosciences), respectively ...
-
bioRxiv - Immunology 2021Quote: ... cells were initially fixed and permeabilized for 1 hour using the Foxp3/Transcription Factor Staining Buffer Set (eBioscience) and then stained using the PE-conjugated anti-p53 Set (BD Biosciences), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... anti-mouse IFN-γ ELISA set (Cat no. – 555138) and anti-human IL-10 ELISA set (Cat no. – 555157) were purchased from BD Biosciences ...
-
bioRxiv - Systems Biology 2023Quote: ... Cells were fixed and permeabilized with the eBioscience™ Foxp3 / Transcription Factor Staining Buffer Set or the Transcription Factor Buffer Set (BD Biosciences). Extracellular nonspecific binding was blocked with the anti-CD16/CD32 antibody (clone 2.4G2 ...
-
bioRxiv - Immunology 2020Quote: ... using the BD Cytofix/Cytoperm buffer set (BD Biosciences) per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... incubated AEC substrate (BD Biosciences AEC substrate set, 551951) at room temperature until spots appear ...
-
bioRxiv - Microbiology 2021Quote: ... and the human IL-8 set (BD Biosciences; # BD555244).
-
bioRxiv - Cancer Biology 2022Quote: ... the Foxp3/Transcription Factor Staining Buffer Set (BD Biosciences), anti-Foxp3 and anti-CTLA-4 were used according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... fixed using the transcription factor buffer set (BD Biosciences) followed by intracellular staining for 60 minutes at 4C ...
-
bioRxiv - Immunology 2019Quote: ... Compensation matrices were set using compensation beads (BD Biosciences) and ArC™ Amine Reactive Compensation beads (Thermofisher ...
-
bioRxiv - Cell Biology 2021Quote: ... Beads= Anti Ms Ig CompBead Plus Set (BD, 560497).
-
bioRxiv - Immunology 2022Quote: ... and the Transcription Factor buffer set (562725, BD Biosciences), respectively ...
-
bioRxiv - Pathology 2022Quote: ... set human IL-6 (BD Biosciences, San Diego, USA), and TNF (BD Biosciences ...
-
bioRxiv - Microbiology 2023Quote: ... and TMB Substrate Reagent Set were purchased from BD Biosciences.
-
bioRxiv - Immunology 2023Quote: ... or by Transcription Factor Buffer Set (BD Biosciences, 562574) for co-staining of Foxp3 (transcription factors ...
-
bioRxiv - Immunology 2023Quote: ... The Mouse FoxP3 Fixation and Permeabilization Buffer Set (BDBiosciences) was used for Tox intracellular staining ...
-
bioRxiv - Neuroscience 2021Quote: Subjects used for miR-499-5p expression analysis on psychiatrically healthy controls (Control) or Bipolar disorder patients (BD). One-way-ANOVA was performed to evaluate significant differences between groups ...
-
bioRxiv - Immunology 2019Quote: ... Detection was done with TMB Substrate Reagent Set (BD OptEIA) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... or BD Mouse IFN-gamma ELISA Set (BD Biosciences, 555138) according to the manufacturer’s protocol ...