Labshake search
Citations for Becton, Dickinson and Company :
1 - 50 of 225 citations for Two Hybrid cDNA Library since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Two hybrid plasmid pKBB486 (Crm1-BD) was constructed by PCR amplification of full-length CRM1 using oligonucleotides 5’- TGAAGATACCCCACCAAACCCAAAAAAAGAGATCGAATTCCAGCTGACCACCATGGAAGGAATTTTGGA TTTTTCTAACG-3’ and 5’- TTTTCAGTATCTACGATTCATAGATCTCTGCAGGTCGACGGATCCCCGGGAATTGCCATGTAATCATCAA GTTCGGAAGG-3’ ...
-
bioRxiv - Neuroscience 2020Quote: The vector used to insert the bait cDNAs in the yeast two-hybrid (YTH) screens was Gal4 DNA binding domain (Gal4-BD) expression vector pAS2-1 (Clontech ...
-
bioRxiv - Developmental Biology 2021Quote: Two-hybrid plasmids containing the Drosophila Egl (Egl; CG4051) full-length (pEgl-AD and pEgl-BD), BicD full-length (pBicD-AD and pBicD-BD ...
-
bioRxiv - Plant Biology 2021Quote: The interaction between MPK3 and ABI5 was checked using the Matchmaker yeast two-hybrid system (BD Biosciences) as described previously with slight modifications (Sheikh et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... All yeast two-hybrid screens and assays were performed using the BD Matchmaker system (BD Biosciences, Clontech Laboratories) utilizing the Saccharomyces cerevisiae strain AH109 essentially as described earlier (Stephan et al. ...
-
bioRxiv - Microbiology 2021Quote: ... from pDONR207 into the yeast two-hybrid vector pPC97-GW for expression in fusion downstream of the GAL4 DNA-binding domain (GAL4-BD). The control siRNA and a pool of TAX1BP1 siRNA (Ambion ...
-
PPARγ is a tumor suppressor in basal bladder tumors offering new potential therapeutic opportunitiesbioRxiv - Cancer Biology 2019Quote: ... The GAL4 DNA-binding domain cloning vector pM and the activation-domain cloning vector pVP16 are part of the Mammalian Matchmaker Two-Hybrid Assay kit (BD Biosciences Clontech). The construct pM-MED1 (510-787 ...
-
bioRxiv - Physiology 2022Quote: ... Then final cDNA library was generated from double strand full length cDNA by random priming amplification with BD Rhapsody cDNA Kit (BD Biosciences, Cat. No. 633773) and BD Rhapsody Targeted mRNA & AbSeq Amplification Kit (BD Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... cDNA libraries were prepared using the BD Rhapsody Whole Transcriptome Analysis Amplification Kit (633801 BD Biosciences) following the BD Rhapsody System mRNA Whole Transcriptome Analysis (WTA ...
-
bioRxiv - Immunology 2023Quote: ... A mouse enterocyte cDNA library was used for Y2H screening with Gal4 DNA binding domain (BD)-tagged iTie as a bait ...
-
bioRxiv - Immunology 2024Quote: ... cDNA libraries were prepared using the BD Rhapsody Whole Transcriptome Analysis Amplification Kit (633801 BD Biosciences) following the BD Rhapsody System mRNA Whole Transcriptome Analysis (WTA ...
-
bioRxiv - Immunology 2024Quote: ... Targeted cDNA libraries of genes in the BD Rhapsody Immune Response Panel Mm (BD Biosciences, #633753), supplemented with additional genes (Table 2) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: Two reviewers (ZL and BD) independently extracted data using a standardised data extraction form (Supplementary Table 2) ...
-
bioRxiv - Bioengineering 2023Quote: ... Mixing was achieved by pumping the two materials in two 10mL syringes (BD Emerald, NY, USA) back and forth through a 90-degree syringe luer lock connector (McMaster-Carr ...
-
bioRxiv - Immunology 2019Quote: Single-cell capture and cDNA library preparation was performed using the BD Rhapsody Express Single-cell analysis system (BD Biosciences), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: Single-cell capture and cDNA library preparation were performed using the BD Rhapsody Express Single-Cell Analysis System (BD Biosciences) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... we operated two cell sorters (FACSAria; BD) simultaneously for wild type and gene-defective cells ...
-
bioRxiv - Immunology 2021Quote: ... 250.000 PBMCs per sample (two patients and two healthy controls) were incubated with an individual oligo-labelled antibody (Multiplex Tag, BD Human Single-Cell Multiplexing Kit ...
-
bioRxiv - Immunology 2022Quote: ... Following two washes with Perm/Wash buffer (BD), cells were stained with IFN-γ PE and TNF-α AF488 1:75 each in 50 μL/well Perm/Wash buffer for 30 minutes at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... After two washing steps in Perm/Wash (BD), intranuclear staining was performed at 4 °C overnight in the dark using the FITC anti–human Ki-67 antibody (BD ...
-
bioRxiv - Cancer Biology 2020Quote: ... Two microliters of Annexin-V-FITC (BD, Cat# 556454) and 7-amino-actinomycin D (7-AAD ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: Method two (Calibration Curve-Basal Diet Phosphorus (CC-BD)) ...
-
bioRxiv - Microbiology 2021Quote: ... Verification of positive growing hybrids was performed using a BD LSRFortessa system and FACSDiva software (BD Biosciences) to detect cells positive for both mCherry and tdTomato (Sup ...
-
bioRxiv - Cancer Biology 2022Quote: ... Spontaneous hybrid cells were observed after 2 days by flow cytometry using LSRFortessa flow cytometer (BD Bioscience). To obtain the stable spontaneously fusion cells ...
-
bioRxiv - Neuroscience 2022Quote: ... The tasks are coded in two dimensions: behavioural domains (BD) and paradigm classes (PC) ...
-
bioRxiv - Neuroscience 2022Quote: Two movement disorders specialists certified for MDS-UPDRS (BD, MM) and three neurologists trained for movement disorders ...
-
bioRxiv - Immunology 2023Quote: ... Single-cell cDNA synthesis was performed using BD Rhapsody cDNA Kit (BD) following the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2019Quote: Two electrodes (25G x 5/8 BD™ Regular Bevel Needles) were inserted behind the posts into each MyoTACTIC well to generate an electric field parallel to the fibers ...
-
bioRxiv - Microbiology 2020Quote: ... colistin solutions were added to two batches of molten MHA (BD) to render 2.0 μg/ml and 3.0 μg/ml colistin (final concentration) ...
-
bioRxiv - Microbiology 2022Quote: ... Two polypropylene tubes were allocated in each one of those (BD intradermic ...
-
bioRxiv - Immunology 2023Quote: ... After two washes cells were fixed with 4 % paraformaldehyde (Cytofix, BD) for 30 min at 4°C and analysed by flow cytometry ...
-
bioRxiv - Biochemistry 2021Quote: ... Detection was performed using a two-component peroxidase substrate kit (BD biosciences) and the reaction was stopped with the addition of 2N Sulfuric acid ...
-
bioRxiv - Cell Biology 2021Quote: ... lentiviral vector cloned on pRRL-IRES-mCherry from NdeI/MluI digested parent AcGFP-Sec61B vector Addgene #15108) and two subsequent rounds of stringent sorting (FACS Aria, BD Biosciences) of EGFP positive cells with a fluorescence range within one order ...
-
bioRxiv - Genomics 2022Quote: ... the biomass from two-months growth in Lowenstein-Jensen tubes (BD, BBL) was resuspended in 400 μL of 1X TE buffer ...
-
bioRxiv - Immunology 2022Quote: ... washed two times and analyzed on a Fortessa flow cytometer (BD Biosciences). BV staining buffer was used when multiple BV dyes were used together (BD Biosciences) ...
-
bioRxiv - Microbiology 2021Quote: ... Two other media were used: Luria–Bertani (LB) Miller broth (BD Biosciences) and BBL cation-adjusted Mueller–Hinton II (MH ...
-
bioRxiv - Immunology 2023Quote: ... emulsion and boosted with two Incomplete Freund’s Adjuvant (IFA; 263910, BD Biosciences) emulsions spaced two weeks apart ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were sorted on two BD FACSAria II Cell Sorters (BD Biosciences) equipped with a blue 488 nm laser with a 505 nm long pass mirror and 525/50 nm filter (for mNG) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... cDNAs were then synthesized using a Marathon cDNA amplification kit (BD Biosciences, Franklin Lakes, NJ). The BRh coding region was cloned into pGEM-T easy vector (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... We tested two different commercial MRS formulations (BD Difco™ and Hardy Criterion). The BD Difco™-formulated media is referred to as “MRS” while the Hardy Criterion-formulated media is referred to as “HMRS” throughout this paper ...
-
bioRxiv - Developmental Biology 2022Quote: ... Data from two independent experiments were analyzed using FACS Diva software (BD Biosciences).
-
bioRxiv - Immunology 2023Quote: ... Fixed cells were washed two times with 1x perm/wash buffer (BD, 554723) or with 1x Permeabilization Buffer (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... Cells were washed two times with Perm/Wash buffer (BD Biosciences, 51-2091KZ) and then incubated with antibodies against intracellular antigens diluted in Perm/Wash buffer for 45 min at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... The device consisted of two 5-mL syringes (Luer-lok syring, 309646, BD) and one 3-way stopcock (Discofix® 3-way Stopcock ...
-
bioRxiv - Pathology 2024Quote: ... Two-color flow cytometric analysis was performed using BD AccuriTM C6 (BD Biosciences). The data were analyzed using FCAP Array analysis software version 3.0 (BD Biosciences ...
-
bioRxiv - Plant Biology 2020Quote: ... One week plants were then grown hydroponically for two weeks in Broughton & Dillworth (BD) liquid medium [23] ...
-
bioRxiv - Immunology 2022Quote: ... Cells were stimulated for two hours before 1 uL/well brefeldin A (BD GolgiPlug) was added ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: We conducted four blocks of experiments on the two groups of monkeys (BD, AK). Each block consisted of two parts ...
-
bioRxiv - Bioengineering 2021Quote: ... Two days after transfection cells were single cell sorted using a FACSJazz (BD Bioscience), gating for GFP positive cell population as described previously46 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The surviving cells were sorted in two steps using BD FACSAria SORP (BD Bioscience) as follows ...