Labshake search
Citations for Becton, Dickinson and Company :
1 - 50 of 1248 citations for RNA Amplification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Targeted mRNA and AbSeq Amplification Kit (BD), and Immune Response Panel Mm (BD ...
-
bioRxiv - Immunology 2021Quote: ... Amplification kit and BD Single-Cell Multiplexing kit (BD Biosciences). Size-distribution (Quality ...
-
bioRxiv - Immunology 2023Quote: ... The BD Rhapsody Targeted mRNA and AbSeq Amplification Kit (BD Biosciences) was used to create the cDNA library ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the BD Rhapsody Targeted mRNA & AbSeq Amplification Kit (633774, BD Biosciences). All the libraries were sequenced in a PE150 mode (Pair-End for 150bp read ...
-
bioRxiv - Immunology 2020Quote: ... and AbSeq amplification and BD Single-cell Multiplexing kits and protocol (BD – 633771). Quality of final libraries was assessed using Agilent 2200 TapeStation with High Sensitivity D5000 ScreenTape ...
-
bioRxiv - Physiology 2022Quote: ... and BD Rhapsody Targeted mRNA & AbSeq Amplification Kit (BD Biosciences, Cat No. 633774). All the libraries were sequenced in a PE150 mode (Pair-End for 150bp read ...
-
bioRxiv - Pathology 2021Quote: ... scRNA-seq libraries were constructed using BD Rhapsody™ WTA Amplification Kit (BD, 633801). The libraries were finally sequenced using an Illumina Novaseq6000 sequencer with a sequencing depth of at least 50,000 reads per cell with pair-end 150 bp (PE150 ...
-
bioRxiv - Immunology 2022Quote: ... DNA library preparation was performed using the BD Rhapsody WTA Amplification Kit (BD Biosciences) according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... cDNAs were then synthesized using a Marathon cDNA amplification kit (BD Biosciences, Franklin Lakes, NJ). The BRh coding region was cloned into pGEM-T easy vector (Promega) ...
-
bioRxiv - Molecular Biology 2024Quote: ... (GuangZhou, China) following the manufacturer’s instructions using BD Rhapsody WTA Amplification kit (BD Biosciences, #633801). Briefly ...
-
bioRxiv - Immunology 2021Quote: ... cDNA libraries were prepared using the BD Rhapsody Whole Transcriptome Analysis Amplification Kit (633801 BD Biosciences) following the BD Rhapsody System mRNA Whole Transcriptome Analysis (WTA ...
-
bioRxiv - Immunology 2024Quote: Libraries were prepared using the BD Rhapsody targeted mRNA and Abseq amplification kit (BD Biosciences, 633774). Targeted amplification of cDNA was performed using a mouse immune response panel (397 genes ...
-
bioRxiv - Immunology 2024Quote: ... cDNA libraries were prepared using the BD Rhapsody Whole Transcriptome Analysis Amplification Kit (633801 BD Biosciences) following the BD Rhapsody System mRNA Whole Transcriptome Analysis (WTA ...
-
bioRxiv - Developmental Biology 2023Quote: ... Single cells were captured and libraries prepared using the BD Rhapsody system with the BD Rhapsody cDNA Kit (Cat. No. 633773) and Whole Transcriptome Analysis (WTA) Amplification Kit (BD Biosciences, 633801). The WTA and Sample Tag libraries were amplified and purified according to the manufacturer’s protocol (https://www.bdbiosciences.com/content/dam/bdb/marketing-documents/BD_Rhapsody_System_mRNA_Whole_Transcriptome_Analysis_and_Sample_Tag_Library_Preparation_Protocol.pdf) ...
-
bioRxiv - Immunology 2024Quote: ... were prepared using the BD Rhapsody Targeted mRNA and AbSeq Amplification kit and protocol (BD Biosciences, # 633774). The final libraries quality was assessed using an Agilent 2200 TapeStation with HS D5000 ScreenTape (Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... The 5’ end regions of MIC14 and MIC15 were amplified using the SMART RACE cDNA Amplification Kit (Clontech BD) using total or poly(A)+tachyzoite RNA (strain RH ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were then prepared using the BD Rhapsody WTA Amplification Kit (#633801) following instructions of the mRNA WTA Library Preparation Protocol (BD Biosciences). For the MULTI-seq library first the BD protocol of Sample Tag Library Preparation was followed until purification of Sample Tag PCR1 product with the difference of adding the MULTI-seq primer (sequence according to McGinnis and Patterson et al.5 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The final cDNA library was generated from double strand full length cDNA by random priming amplification with the BD Rhapsody cDNA Kit (633773, BD Biosciences) and the BD Rhapsody Targeted mRNA & AbSeq Amplification Kit (633774 ...
-
bioRxiv - Physiology 2022Quote: ... Then final cDNA library was generated from double strand full length cDNA by random priming amplification with BD Rhapsody cDNA Kit (BD Biosciences, Cat. No. 633773) and BD Rhapsody Targeted mRNA & AbSeq Amplification Kit (BD Biosciences ...
-
bioRxiv - Neuroscience 2023Quote: ... single cell RNA sequencing libraries were prepared using the Rhapsody WTA kit (BD Biosciences). The Rhapsody ...
-
bioRxiv - Immunology 2024Quote: ... Targeted amplification of cDNA was performed using a mouse immune response panel (397 genes, BD Biosciences, 633753) and a custom additional panel of 99 genes (covering leukocyte lineage- and kidney cell-specific genes ...
-
bioRxiv - Cell Biology 2020Quote: ... Amplification and visualization was performed using secondary antibody (1:50, goat anti-Rat IgG, BD Pharmingen, Heidelberg, Germany) conjugated with biotin (visualised by using Vectastein ALP Kit ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by signal amplification using biotinylated rat anti-mouse IgG (Jackson Immunochemicals) and streptavidin-allophycocyanin (APC) (BD Biosciences). Propidium Iodide (Sigma-Aldrich p-4864 ...
-
bioRxiv - Systems Biology 2021Quote: ... BD Sample Tags were size-separated by SPRI selection after cDNA amplification and amplified according to standard protocols (BD User-Demonstrated Protocol ...
-
Rbx1 Cullin-Ring ligase E3 and Ube2m neddylation E2 differentially governs the fitness of Treg cellsbioRxiv - Immunology 2020Quote: ... Whole transcriptome libraries were prepared using the BD Resolve system for single-cell whole-transcriptome amplification workflow (BD Genomics) to capture transcriptomic information of the sorted single cells ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Lateral light scatter (SSC) and SYBR-green fluorescence (FITC) measurements were performed with logarithmic amplification using FlowJo software (BDBiosciences). Virus and virophage samples were immediately collected for DNA extraction and quantified by ddPCR (see above and (51)).
-
bioRxiv - Systems Biology 2021Quote: ... BD Sample Tags were size-separated by SPRI selection after cDNA amplification and amplified according to standard protocols (BD User-Demonstrated Protocol: BD Single-Cell Multiplexing Kit—Human Doc ID ...
-
bioRxiv - Neuroscience 2020Quote: ... The EGFP+stop cassette was inserted in-frame into exon 1 at the AgeI site following amplification from pEGFP-C1 (BD Biosciences) using primers 2-For and 2-Rev ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then subjected to a series of signal amplification cycles and then analyzed by flow cytometry as described above using FlowJo software (BD Biosciences).
-
bioRxiv - Molecular Biology 2021Quote: ... The cells that were transfected with a fLuc RNAs were permeabilized with Fixation/ Permeabilization solution kit (BD Biosciences, UK) for 20 min before washing them with 2.5 mL of FACS buffer and centrifuging at 1750 rpm for 7 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Immunology 2021Quote: Testing for GC and CT in first-void urine samples was performed by nucleic acid amplification test (NAAT; ProbeTech Assay, BD, Sparks, MD). Testing for HIV-1/2 and syphilis were performed by chemiluminescent microparticle immunoassay (CMIA ...
-
bioRxiv - Neuroscience 2023Quote: Cells were directly sorted into 1.5 ml tubes containing 100 µl of extraction buffer (XB, Arcturus PicoPure RNA isolation kit) with a FACSAria III SORP (BD Biosciences) flow cytometer equipped with a 90 µm-diameter nozzle ...
-
bioRxiv - Genetics 2022Quote: RNA was extracted from whole blood in PaxGene RNA tubes (762165, BD, New Jersey) containing additives that inhibit RNA degradation ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA lacks the overlapping region (BD) targeting Uchl1 sense mRNA ...
-
Replication Timing and Transcription Identifies a Novel Fragility Signature Under Replication StressbioRxiv - Genetics 2019Quote: ... and Bru-labeled RNA was isolated by incubation of the isolated total RNA with anti-BrdU antibodies (BD Biosciences) conjugated to magnetic Dynabeads (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... tPE-all-RNA or snPE-all-RNA (BFP+) double-positive cells were collected from flow cytometry (BD FACS Aria III). The genomic DNA of cells was extracted using QuickExtract DNA Extraction Solution (Lucigen ...
-
bioRxiv - Immunology 2023Quote: ... or PAXgene® Blood RNA Tube (BD, 762165). RNA isolation ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells from mouse tail skin (aging RNA-seq) and dorsal/ventral skin (fibulin 7 RNA-seq) were isolated using FACS Aria flow cytometer (BD Biosciences). Data were analyzed using FlowJo software (BD Biosciences).
-
bioRxiv - Genomics 2019Quote: ... umbilical cord blood was collected at the time of birth in PAXgene Blood RNA Tubes with the RNA stabilization reagent (BD Biosciences) and stored at −80°C ...
-
bioRxiv - Microbiology 2021Quote: ... a BrdU assay kit (APC BrdU flow kit, BD Pharmingen) was used as directed by the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2020Quote: ... TUNEL kit from BD Pharmingen were used for assessment of apoptotic cells following manufacturer’s instruction as described (47 ...
-
bioRxiv - Cell Biology 2021Quote: ... Fixation/Permeabilization kit (BD Biosciences ...
-
bioRxiv - Immunology 2020Quote: ... OptEIA ELISA kits (BD) for mouse were used ...
-
bioRxiv - Systems Biology 2019Quote: Whole Blood was collected in PAXGene Blood RNA Tubes (BD Biosciences). Total RNA including small RNAs were isolated using PAXGene Blood miRNA kit (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... Bru-labeled RNA was immunocaptured using anti-BrdU antibodies (BD Biosciences). Anti-BrdU monoclonal antibody was conjugated to magnetic beads and incubated with the RNA ...
-
bioRxiv - Microbiology 2023Quote: ... RNA-Seq was performed for MG1655 grown in LB (BD#244620). Cells growth and RNA preps were prepared as previously described (see methods section titled ...
-
bioRxiv - Neuroscience 2020Quote: Serum and CSF Fetuin-A was measured with an ELISA kit (ELISA Kit, BD ELISA MBS019821 ...
-
Histone H3K36me2-specific methyltransferase ASH1L is required for the MLL-AF9-induced leukemogenesisbioRxiv - Cancer Biology 2021Quote: ... The c-kit+ HPCs were isolated using c-Kit antibody-conjugated IMag (BD Biosciences) beads ...
-
bioRxiv - Immunology 2019Quote: ... using Multiplex CBA kit (BD Cytometric Bead Array Th1/Th2/Th17 ...