Labshake search
Citations for Becton, Dickinson and Company :
1 - 28 of 28 citations for PCR strip since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and an anaerobic indicator strip (BD). Culture chambers were evacuated and flushed with N2 before incubation for 28 days at 30°C ...
-
bioRxiv - Microbiology 2021Quote: ... Anaerobic indicator strips (BD GasPak, Franklin Lakes, NJ) were placed in the bottles to confirm the absence of oxygen ...
-
bioRxiv - Immunology 2020Quote: ... Anaerobic conditions were confirmed using BBL™ Dry Anaerobic Indicator Strips (BD #271051). Colonies were counted after 24 h and quantified.
-
bioRxiv - Developmental Biology 2019Quote: ... Strips of somite mesoderm were dissected and collected in 4-chambered cell culture slides (BD Falcon) containing L-15 medium and sheep serum (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2019Quote: ... Maintenance of hypoxic conditions (less than 1% O2 and greater than 13% CO2) was monitored using Dry Anaerobic Indicator Strips (BD).
-
bioRxiv - Microbiology 2020Quote: ... Maintenance of hypoxic conditions (less than 1% O2 and greater than 13% CO2) was monitored using Dry Anaerobic Indicator Strips (BD).
-
bioRxiv - Microbiology 2021Quote: ... vancomycin, erythromycin and moxifloxacin using gradient antibiotic strips (Etest®, BioMérieux, Marcy l’Etoile, France) on Brucella agar plates (BD Biosciences, Oxford, UK) was tested for all the isolates ...
-
bioRxiv - Microbiology 2024Quote: ... The maintenance of anaerobic conditions was confirmed by a strip of methylene blue-containing indicator (Dry Anaerobic Indicator; BD BBL, Franklin Lake, NJ, USA) in the jar ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were purified with AMPure Beads (BD Bioscience ...
-
bioRxiv - Cancer Biology 2023Quote: ... 12 μl Bead RT/PCR Enhancer reagent from BD Biosciences and 72 μl nuclease free water for a total volume of 200 μl ...
-
bioRxiv - Molecular Biology 2021Quote: ... Final PCR products were purified with AMPure Beads (BD Bioscience). The library was prepared with PCR products pooled in equimolar amounts following the manufacture’s protocol and loaded in a Micro MiSeq Reagent Kit v2 (500-cycles ...
-
bioRxiv - Cell Biology 2023Quote: ... Final PCR products were purified with AMPure Beads (BD Bioscience). The library was prepared with PCR products pooled in equimolar amounts following the manufacture’s protocol and loaded in a Micro MiSeq Reagent Kit v2 (500-cycles ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were purified with AMPure Beads (BD Bioscience, US). For the second (PCR2) ...
-
bioRxiv - Immunology 2022Quote: ... Real-time PCR was performed with the QuantStudio3 System (BD Biosciences) using SYBR Premix Ex Taq II mix (TaKaRa Bio ...
-
bioRxiv - Physiology 2021Quote: ... The PCR product was cloned into a pIRES2-EGFP expression vector (BD Biosciences Clontech Franklin Lakes ...
-
bioRxiv - Immunology 2023Quote: ... Final products for library index PCR were diluted with elution buffer (BD Biosciences) into 2 ng/μl of mRNA targeted PCR2 product and 1 ng/μl of sample tag PCR2 product ...
-
bioRxiv - Biochemistry 2023Quote: PCR reactions were performed with PrimeSTAR MAX DNA Polymerase (BD Clontech GmbH, Heidelberg, Germany) or Phusion High-Fidelity polymerase (Thermo Fisher Scientific GmbH ...
-
bioRxiv - Genetics 2019Quote: ... DNA was amplified by PCR and fragments of inappropriate sizes were removed using Agencourt AMPure XP beads (BD). Finally ...
-
bioRxiv - Genetics 2019Quote: ... DNA was amplified by PCR and fragments of inappropriate sizes were removed using Agencourt AMPure XP beads (BD). Finally ...
-
A Phytochrome B-PIF4-MYC2 Module Tunes Secondary Cell Wall Thickening in Response to Shaded LightingbioRxiv - Plant Biology 2021Quote: The coding sequence of MYC2 PCR-amplified from cDNA using PHANTA was fused with GAL4 DNA-binding domain (BD) of the bait vector pGBKT7 (Clontech) ...
-
bioRxiv - Plant Biology 2023Quote: ... The plasmid transduction into the above-mentioned yeast strains was confirmed by PCR (KK70/CY179 for AGB1.x-BD, KK281/CY180 for AGG1-AD ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Neuroscience 2020Quote: ... the isolated cells with fluorescence signals were sorted and enriched directly into 0.2-μl PCR tubes by a FACS machine (BD Influx). Noted that ...
-
bioRxiv - Plant Biology 2022Quote: ... and the PCR products were fused into the activation domain (AD) vector pGADT7 and/or the DNA-binding domain (BD) vector pGBKT7 and verified by sequencing ...
-
bioRxiv - Plant Biology 2024Quote: ... the truncated HAF2 coding regions were obtained by RT-PCR from Col-0 cDNA and then cloned into pEXPAD502 (AD) and pDBLeu (BD) backbone ...
-
bioRxiv - Immunology 2023Quote: ... P33681) without the leader sequence was PCR-amplified and cloned into the pAcGP67 of the BaculoGold Baculovirus Expression System (BD Biosciences). This vector was modified so that all proteins featured a C-terminal H12-tag ...
-
bioRxiv - Cell Biology 2021Quote: ... The cyclin D1-GFP plasmids were constructed by combining the PCR fragment of cyclin D1 from the cyclin D1-Flag plasmid and GFP from pEGFP-N1 (BD Biosciences Clontech) into XPack CMV constructs (System Biosciences) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...