Labshake search
Citations for Becton, Dickinson and Company :
1 - 50 of 3725 citations for Mouse NXPE4 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... double-stranded oligonucleotides encoding short hairpin RNAs (shRNAs) targeting the mouse E-cadherin mRNA were annealed and then cloned into the pSIREN-RetroQ retroviral vector (BD Biosciences; Franklin Lakes, NJ). The shRNA targeting sequence for E-cadherin was 5’-TACATCCTTCATGTGAGAGTG-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: GFP-expressing FC1245 cells transduced with shRNAs or EV were counted by an InFluxTM cell sorter (BD) and seeded into 96 well plates with 1,000 cells per well ...
-
bioRxiv - Biochemistry 2019Quote: ... Clones with high expression of shRNA after doxycycline induction were expanded and sorted using a BD FACSAria™ III (BD Biosciences-US ...
-
bioRxiv - Biochemistry 2019Quote: ... shRNA expression was induced by doxycycline (2 μg/ml) and sorted using a BD FACSAria™ III (BD Biosciences-US) cell sorter to select for the high TurboRFP expressing cells ...
-
bioRxiv - Cell Biology 2020Quote: pEGFP plasmid (BD Biosciences) was transfected into NIH 3T3 fibroblasts using lipofectamine reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2019Quote: ... MDA-MB-231 parental or HSF1 KO with either scrambled control or DYRK2 knock-down shRNA (1 or 2) were counted and suspended in sterile phosphate buffer saline containing 50% Matrigel (BD Bioscience). 300,000 cells (100 μl ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were analyzed for GFP expression (shRNA expression) and viral antigen by flow cytometry on a BD FACS Array flow cytometer (BD Biosciences). Data were processed using FlowJo analysis software (Tree Star ...
-
bioRxiv - Cancer Biology 2020Quote: ... One million of 22Rv1 cells with stable transduction of shRNA or control empty vector were suspended in 100ul of PBS with 50% Matrigel (BD Biosciences) and then subcutaneously (s.c. ...
-
bioRxiv - Immunology 2019Quote: Cell suspensions transduced with shRNA lentiviruses were harvested and run on a BD FACSCanto II or BD Fortessa flow cytometer (all BD Biosciences) and data analysed with FlowJo software (Tree Star ...
-
bioRxiv - Cancer Biology 2019Quote: DMS-53 cells transduced with DARPP-32 shRNAs or exogenously overexpressed DARPP-32 isoforms were stained with Annexin V-FITC antibodies (BD Biosciences) to assess apoptosis ...
-
bioRxiv - Cancer Biology 2020Quote: ... 6.6×105 starved MDAMB231 cells expressing the shRNA library (or control cell line) were plated onto 6-well transwell chambers (8 μm pore size membrane; BD Bioscience, Bedford, MA) in assay medium ...
-
bioRxiv - Cancer Biology 2020Quote: ... 6.6×105 starved MDA-MB-231 cells expressing the shRNA library (or control cell line) were plated onto 6-well Boyden chambers (8 μm pore size membrane; BD Bioscience, Bedford, MA) in assay medium ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-mouse or human RIPK1 (BD Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... anti-mouse CD16/CD32 (mouse BD Fc block) mAb clone 2.4G2 (BD Bioscience ...
-
bioRxiv - Immunology 2021Quote: ... anti-mouse CD16/CD32 (mouse BD Fc block) mAb clone 2.4G2 (BD Bioscience ...
-
bioRxiv - Immunology 2021Quote: ... anti-mouse CD16/CD32 (mouse BD Fc block) mAb clone 2.4G2 (BD Bioscience ...
-
bioRxiv - Microbiology 2023Quote: ... Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block™ ...
-
bioRxiv - Immunology 2023Quote: ... BUV395 Mouse Anti-Mouse CD45.2 (Clone 104; BD Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... Slc37a2 plEGFP-C1 plasmid or plasmid vector control were transfected into Amphopack-293 cells (BD Biosciences) to produce viral particles that were used to infect RBL-2H3 cells or RBL-2H3 cells stably expressing serglycin-mCherry ...
-
bioRxiv - Cell Biology 2020Quote: ... Two hybrid plasmid pKBB486 (Crm1-BD) was constructed by PCR amplification of full-length CRM1 using oligonucleotides 5’- TGAAGATACCCCACCAAACCCAAAAAAAGAGATCGAATTCCAGCTGACCACCATGGAAGGAATTTTGGA TTTTTCTAACG-3’ and 5’- TTTTCAGTATCTACGATTCATAGATCTCTGCAGGTCGACGGATCCCCGGGAATTGCCATGTAATCATCAA GTTCGGAAGG-3’ ...
-
bioRxiv - Immunology 2021Quote: ... biotinylated mouse anti-mouse IgG2a (Clone R19-15, BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... PE mouse FoxP3 and BV421 mouse CD25 (BD Biosciences). Appropriate isotype control antibodies (BD Biosciences ...
-
bioRxiv - Molecular Biology 2019Quote: ... or mouse anti-Chk2 mouse mAb (BD Biosciences 611570). As a loading control ...
-
bioRxiv - Molecular Biology 2021Quote: Pan-ubiquitin mouse monoclonal #3939 (Cell Signalling Technology) Mouse/human RIPK1 mouse monoclonal #610458 (BD transduction Laboratories)
-
bioRxiv - Cell Biology 2020Quote: ... Anti-Bip (Mouse, 610979), anti-GM130 (Mouse, 610822) and anti-Tim23 (Mouse, 611223) antibodies were from BD Transduction ...
-
bioRxiv - Cell Biology 2021Quote: ... pmRFP-C1 plasmid was obtained from BD Clontech (Palo Alto ...
-
bioRxiv - Cell Biology 2019Quote: ... Mouse anti-Tim23 and mouse anti-Drp1 were from BD Biosciences ...
-
bioRxiv - Neuroscience 2019Quote: ... Mouse anti-mouse Cav1 (BD Biosciences, 1, 610407, 1:50), Mouse anti-mouse NeuN (Millipore ...
-
bioRxiv - Immunology 2023Quote: ... purified rat anti-mouse CD16/CD32 (Mouse BD Fc Block) (553142) ...
-
bioRxiv - Immunology 2023Quote: ... mouse anti-mouse/human Ki67 647 (B56, all BD Pharmingen), rabbit anti-mouse/human laminin (Abcam) ...
-
bioRxiv - Cell Biology 2022Quote: ... rat anti-mouse CD16/32 (Mouse BD Fc Block, #553142) from BD Biosciences ...
-
bioRxiv - Immunology 2023Quote: ... Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block) (553142) ...
-
bioRxiv - Cell Biology 2019Quote: ... CK1ε (mouse; BD), PPP1CA (mouse ...
-
bioRxiv - Cell Biology 2021Quote: ... antiBrdU(Mouse-BD Biosciences 347580 Lot# 7157935 AbCam Rat Cat#AB6326 multiple lots #GR3173537-7 ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse HIF1α (BD Biosciences ...
-
VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1bioRxiv - Cell Biology 2023Quote: ... mouse GM130 (BD Bioscience ...
-
bioRxiv - Cell Biology 2024Quote: ... Sec31 (mouse; BD), Sec24B (rabbit ...
-
bioRxiv - Cancer Biology 2019Quote: ... mouse anti-mouse β-Catenin (clone 14/ β -Catenin, BD Biosciences); rabbit anti-mouse AKT (9272 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-mouse GS15 primary antibody (610960, BD Transduction Laboratories, UK), rabbit anti-mouse C1q primary antibody (ab71940 ...
-
bioRxiv - Microbiology 2022Quote: ... AF647-conjugated mouse anti-mouse CD64 (X54-5/7.1; BD Biosciences) and AF700-conjugated mouse anti-mouse CD45.2 (104 ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-NR2B (1:200, Clone 13, Mouse 610416, BD Biosciences), mouse monoclonal anti-N2B (1:200 ...
-
bioRxiv - Immunology 2019Quote: ... purified rat anti-mouse CD16/CD32 antibody (Mouse BD Fc Block) (BD Biosciences ...
-
bioRxiv - Immunology 2020Quote: ... Mouse Fc Block (rat anti-mouse CD16/CD32, BD Biosciences 553142) and p84 (provided by Aduro Biotech ...
-
bioRxiv - Plant Biology 2022Quote: ... The following plasmids were generated: pMM213 (BD-ER_CD), pCLL103 (AD-PUB30) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Single cells from digested xenograft tumors were labeled using a BUV395 anti-mouse cocktail (pooled and diluted 1:40: anti-mouse H2kD [BD Biosciences, cat. 742437], anti-mouse CD45 [BD Biosciences ...
-
bioRxiv - Cancer Biology 2023Quote: ... Single cells from digested xenograft tumors were labeled using a BUV395 anti-mouse cocktail (pooled and diluted 1:40: anti-mouse H2kD [BD Biosciences, cat. 742437], anti-mouse CD45 [BD Biosciences, cat. 567451], anti-mouse CD31 [BD Biosciences ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were then blocked with anti-mouse CD16/32 and labeled with cell surface antibody cocktail including anti-mouse CD3-FITC、anti-mouse CD4-APC and anti-mouse CD8-Percp-cy5.5 (BD Bioscience) for 30min at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... and mouse FcR blocker (anti-mouse CD16/CD32, clone 2.4G2, BD Biosciences). After surface staining ...
-
bioRxiv - Immunology 2023Quote: ... and blocked unspecific bindings with using anti-mouse CD16/CD32 (Mouse BD Fc Block ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-EEA1 (BD Biosciences ...